Грунтовки свойства: назначение, виды составов, рекомендации по выбору » Вcероссийский отраслевой интернет-журнал «Строительство.RU»

Содержание

Все, что нужно знать о грунтовке: виды, свойства, состав и назначение

Грунтовка представляет собой один из обязательных материалов при проведении различных ремонтных работ. Она обладает массой функций и назначений, основным из которых является укрепление поверхности. После нанесения грунтов перечень материалов, которые могут быть использованы для отделки поверхности, значительно возрастает. Грунтовку используют для обработки поверхностей перед нанесением шпатлевки, штукатурки, краски и поклейки обоев. Качественная грунтовка имеет отличное сцепление с материалом основания, гарантируя длительный срок службы отделочных материалов.

Аквамарин-ЛКМ предлагает купить грунтовку как для внутренних, так и для внешних работ. Широкий ассортимент видов продукции позволит подобрать оптимальный вариант в зависимости от назначения.

Назначение и особенности использования грунтовки

Основное назначение грунтовки заключается в укреплении пористых поверхностей и оснований, оптимизации их впитывающих свойств.

Грунтовка наносится перед покраской стен и других оснований, чтобы обеспечить равномерное распределение и минимальный расход краски. Если пористую поверхность не загрунтовать, краска будет отслаиваться и осыпаться. Цель использования зависит и от того, что входит в состав грунтовки. Существуют универсальные и специальные смеси.

Основное назначения и функции грунтовки:

  • повышение адгезии слоев отделки, улучшая качество покраски, поклейки обоев, штукатурки и нанесения других материалов;
  • снижение расхода краски и клея;
  • повышение прочности основания, что особенно важно для рыхлых и пористых оснований;
  • при наличии в составе фунгицидных добавок обеспечиваются противогрибковые свойства грунтовки, что особенно важно для помещений с высоким уровнем влажности и наружных работ;
  • специальные белые грунтовки обеспечивают идеальное основание для нанесения красок любых оттенков.

А с учетом того, что грунтовка стоит относительно недорого, ее применение приносит ощутимый экономический эффект.

Аквамарин-ЛКМ является официальным дилером заводов «Квил», «Elcon», «ВИТ» и«BSAQUA». Вся продукция востребована потребителями и занимает лидирующие позиции на отечественном рынке.

Виды грунтовки

Существуют различные виды грунтовок, которые выпускаются в виде сухих смесей, жидких и пастообразных составов. Выпускаются грунтовки для ручного, машинного и универсального нанесения. Применяются они для обработки поверхностей из различных материалов. По назначению грунтовки делятся на такие виды:

  • Универсальная
    Может использоваться для любых ремонтных работ. Отличается хорошей адгезией с различными материалами. Однако чаще всего характеристики универсальной грунтовки уступают специальным составом, разработанных с учетом особенностей определенного материала. К универсальным относится акриловая грунтовка. Также для покрытия различных видов оснований может использоваться и алкидная грунтовка.
  • Для дерева
    Грунтовка для дерева применяется для его защиты от грибка, вредителей и влажности. Придает материалу гладкость и позволяет снижать расход материала при покраске.
  • Для металла
    Грунтовка чаще всего используется для покрытия черных металлов и никелированных сплавов на основе железа. Ее применения облегчает процесс покраски и придает металлу антикоррозийные свойства.
  • Для минеральных оснований
    Применяется для укрепления пористых поверхностей, например, для штукатурки или бетонного основания. Такая грунта обладает отличными проникающими свойствами, снижает расход отделочных материалов. В состав минеральной грунтовки может входить антигрибковое вещество, которое предотвращает образование плесени.

Помимо основных видов грунтовки классифицируются и по типу:

  • Антигрибковая
    Используется во влажных помещениях с недостаточной вентиляцией, чтобы предотвратить развития плесени.
  • Антикоррозийная
    Применяется для обработки металлических поверхностей для их защиты от коррозии.
  • Глубокопроникающая
    Это тип грунтовки используется для отделки старых и пористых поверхностей с целью повышения их прочности. Используется для обработки шпатлевки, гипсокартона, штукатурки. Могут включать в состав компоненты для предотвращения развития грибка
  • Изоляционная
    Изоляционная грунтовка используется для борьбы с высоким уровнем влажности. Применяется для наружных и внутренних работ. Рекомендуется использовать для пористы поверхностей, которые под воздействием штукатурки приобретают прочность и долговечность.
  • Грунт-краска
    Универсальная грунтовка, используемая для пористых и гладких поверхностей. используется в тепло- и гидроизоляционных, отделочных и других ремонтных работах. Способствует защите от излишнего влагопоглощения.
  • Грунт-лак
    Состав одновременно обладает свойствами грунтовки и лака. Используется для обработки деревянных оснований. Может использоваться перед нанесением краски или в качестве финишной отделки. Применяется только для внутренних отделочных работ.

Использование различных видов грунтовок позволяет повысить прочность основания, снизить расход материала, защитить от повышенной влажности, грибка и плесени.

Компания «Аквамарин-ЛКМ» занимается поставками лакокрасочных материалов более 15 лет. Осуществляем прямые поставки с ведущих заводов производителей. Являясь официальными представителями крупных заводов, можем предложить широкий ассортимент продукции по выгодным ценам.

Водная грунтовка: свойства, выбор, технология применения. Водная грунтовка

Чтобы выполнить любые строительные работы грамотно и качественно, обязательно соблюдение сроков и поэтапности. Грунтование — один из подготовительных процессов во время отделочных работ. Растворов этого назначения сегодня очень много, но наиболее востребованными остаются неизменно водные грунтовки. Обо всех особенностях, свойствах, способах применения и разновидностях этой группы строительных смесей вы узнаете из этой статьи.

Грунтовка — определение

Грунтовка — это малярный раствор, состав которого включает наполнитель и связующее. Компоненты могут быть разными, соответственно — разнятся и показатели по тем или иным характеристикам и свойствам. Основные из них — это:

  • скорость высыхания;
  • глубина проникновения в материал;
  • оттенок;
  • качество защиты от влаги, мороза, возгорания, других неблагоприятных воздействий;
  • влияние на свойство основного материала на дальнейшую адгезию с декоративными покрытиями.

Назначение грунтовки

Некоторые считают грунтование вовсе ненужным и умышленно пропускают этот этап. Такой подход в корне неверный, так как именно после обработки любого основания такой смесью, получается следующий результат:

  1. Упрочнение основного строительного материала, что особенно важно для крошащихся и осыпающихся разновидностей.
  2. Повышение адгезионных свойств — недостаток сцепления основы с декоративным материалом может проявиться не сразу, а через небольшой промежуток времени. Применение водной грунтовки исключает риск отпадания, отлипания и возникновения других дефектов после завершения ремонта.
  3. Повышение стойкости к влаге, что очень важно для сырых помещений — подвалов, ванных комнат и т. д.
  4. Снижение пористости поверхности — такая функция позволяет уменьшить расход декоративного раствора при шпаклевании, окрашивании, оштукатуривании.
  5. Создание защитного антисептического слоя, что не дает возможности размножаться грибкам, плесени и другим болезнетворным микроорганизмам.
  6. Препятствие корродированию — эта проблема актуальна для металлических конструкций.
  7. Упрощает окрашивание — после грунтования краска ложится ровным и однородным слоем.
  8. Увеличивает срок службы основного декоративного покрытия и его износостойкость.

Важно! Плотность и расход водно-дисперсионных грунтовок может различаться в зависимости от конкретного изготовителя строительной смеси и компонентного состава. Диапазон показателей охватывает такие цифры:

  • плотность — 0,8-1,55 г/см3;
  • расход — от 40 до 250 мл (г).

Грунтовка на водной основе — свойства

Водные грунтовки не только обладают всеми вышеперечисленными характеристиками.

Выделяются они следующими преимуществами:

  1. Паропроницаемость — естественная циркуляция воздуха способствует стабильно приятному микроклимату в помещении и исключает риск скопления конденсата под декоративным слоем.
  2. Полное отсутствие едкого запаха или ощущается лишь легкий, ненавязчивый аромат, который никоим образом не влияет на удобство продолжения ремонта.
  3. Быстрота схватывания и полного застывания — этот фактор крайне важен для соблюдения сроков строительства и его ускорения.
  4. Отличная проникающая способность, даже в плотные материалы типа искусственного камня.

Важно! Цена водных грунтовок значительно ниже, чем любых других растворов этой группы, поэтому они идеально подходят даже для строительства с минимальным бюджетом.

Правила выбора грунтовки

Выбирая грунтовку, можно отталкиваться от 3 основных критериев:

  • назначение;
  • состав;
  • надежность производителя.

Важно! В зависимости от компонентного состава определяется проникающая способность раствора, соответственно — это влияет на качество защитного слоя и выравнивающее свойство. Для разных материалов подбирается подходящий состав, чтобы получить оптимальный по качеству результат. На эти особенности надо обращать внимание, чтобы грунтование действительно принесло пользу и позволило не сомневаться в прочности и надежности отделки, продлить срок ее службы.

Виды грунтовок по назначению

Как уже сказано выше, грунтовки могут выполнять различные функции. В зависимости от того, какие свойства преобладают, различают такие типы растворов:

  1. Адгезионный. Такие смеси предназначены непосредственно для повышения прочности сцепления нескольких слоев отделки и основания. Наносятся не только на саму основу, но могут использоваться для закрепления каждого последующего слоя при окрашивании, оцинковании или оштукатуривании.
  2. Изолирующий. Состав такой грунтовки зачастую включает вязкие и клейкие вещества — масла, клеи, смолы, пигменты. На поверхности создается после отвердения раствора тонкая пленка, которая предотвращает любое неблагоприятное покрытие.
  3. Укрепляющий. Используется только для начальной обработки поверхности, чтобы укрепить, выровнять ее для дальнейшей отделки. В эту группу входят водно-дисперсионные грунтовки глубокого проникновения. Их основное отличие — это мелкофракционные связующие, что позволяет пропитать основу на толщину до 10 см и заполнить все микротрещины.
  4. Антикоррозийный. Такая грунтовка предназначена исключительно для защитной обработки металлических конструкций.

Важно! Некоторые производители для упрощения задачи выбора для потребителей стали выпускать еще одну группу растворов — грунтовки водно-дисперсионные универсальные, которые используются для отделки различных поверхностей на разных этапах строительства. Применение именно таких растворов целесообразно при небольших объемах отделочных работ в разных помещениях для различных материалов. В таком случае появляется возможность существенно сэкономить и не допустить образования большого количества излишков.

Виды грунтовок по составу

В зависимости от того, какое именно вещество взято за основу, различают несколько видов грунтовок на водной основе.

Грунтовки водные акриловые

Водно-дисперсионная акриловая грунтовка на сегодня самая востребованная. Основу таких растворов составляют акриловые полимеры с различными добавками. Ее использование позволяет создать максимально надежное и прочное сцепление практически любых материалов. В зависимости от конкретного состава, по принципу воздействия такие растворы различаются на следующие виды:

  • водно-дисперсионная грунтовка глубокого проникновения;
  • адгезивная грунтовка.

Производители рекомендуют использовать такие грунтовки для:

  • бетона;
  • древесины;
  • гипсокартона;
  • стекловолокна;
  • штукатурки и шпаклевки.

Важно! Несмотря на бытующее мнение, что водные грунтовки нежелательно применять для металлических элементов, так как сама вода будет способствовать развитию коррозии, оно не является обоснованным. Правильно подобранный компонентный состав акриловой грунтовки на водной основе полностью исключает такой результат и позволяет создать надежный защитный слой не только от влаги, но и от возгорания и негативного влияния всех неблагоприятных атмосферных условий на любых сплавах.

Грунтовки битумные на водной основе

Несмотря на то, что основной компонент — битум, является нефтепродуктом, растворы этого типа являются абсолютно безопасными и нетоксичными, при условии порядочности и надежности изготовителя. Чаще всего применяются водные битумные грунтовки в качестве предварительного слоя при:

  • укладке самоклеящихся гидроизоляционных мембран;
  • монтаже наплавляемых материалов, в том числе кровельных;
  • отделке кирпичных, бетонных стен, фундаментов, подвалов.

Важно! Помимо высокой эластичности, растворы этого типа отличаются высокими антикоррозийными характеристиками и стойкостью к любому агрессивному химическому воздействию — щелочей, кислот.

Грунтовки алкидные

Водно-дисперсионные грунтовки на основе алкидных веществ применяются в основном для материалов, которые отличаются плохой впитываемостью. Помимо отличных антикоррозийных свойства, алкидные составы, растворяемые водой, обладают высокой скоростью высыхания.

Идеально подходят они для внешних и внутренних отделочных работ при обработке:

  • пластика;
  • стекла;
  • металла.

Важно! Алкидные грунтовки нельзя использовать на плитах из гипсокартона и схожего материала. Смолы будут вызывать ворсистость поверхности.

Грунтовки латексные

Водно-дисперсионные грунтовки на латексной основе по своим характеристикам превосходят и алкидные и акриловые растворы. Отмечаются значительно более высокие показатели по таким эксплуатационным параметрам:

  • влагостойкость;
  • морозоустойчивость;
  • адгезия.

Важно! Еще один очень важный нюанс — латексные составы допустимо применять даже на ранее окрашенных поверхностях, без предварительной подготовки и удаления слоев краски.

Грунтовки на силиконовой основе

Растворы на силиконовой основе — это универсальные водно-дисперсионные грунтовки, пригодные для любого типа отделочных работ. В частности, очень часто им отдают предпочтение при окрашивании фасада либо при необходимости прогрунтовать пористые материалы либо окрашенные/неокрашенные каменные конструкции.

Отличительные свойства силиконовых грунтовок — это:

  • высокая паропроницаемость;
  • максимально возможный показатель морозоустойчивости;
  • оптимальное укрепление поверхности.

Важно! Цена силиконовых грунтовок достаточно высокая, но она полностью оправдана качеством и надежностью. Главное условие — выбрать продукции хорошо зарекомендовавшего себя бренда.

Популярные производители грунтовок

Чтобы быстрее определиться с подходящей для вашего строительства грунтовкой, просмотрите серии продукции хорошо зарекомендовавших себя производителей. К таким относятся:

  1. Knauf. Этот бренд стойко выдерживает первенство на рынке по своей популярности. Широчайшая линия продукции в группе строительных смесей отличного качества по вполне приемлемой цене — далеко не полный перечень достоинств. Среди товаров этой компании легко найти именно то, что надо для решения даже специфических задач. К примеру, интерес вызывает быстросохнущий, бесцветный раствор Tiefengrund, который можно использовать даже на таких материалах, как гипсо-волокнистые плиты любого типа и наливные полы.                                                                                                                                        
  2. Бирсс. Группа компаний, которые осуществляют свою деятельность на территории РФ. Относительно новый бренд, который завоевал популярность потребителей доступностью своей продукции и высоким качеством материалов. За все время работы потребители оставляли только положительные отзывы после того, как решались опробовать строительные смеси «Бирсс». Один из наиболее часто приобретаемых товаров — грунтовка «Бирсс» водно-дисперсионная «Бетон контакт» — специального назначения для обработки бетонных поверхностей любого типа: фундаментов, полов, стен как снаружи, так и внутри зданий.
  3. Норт. Отечественный производитель, который за почти 15 лет своей деятельности смог выделиться на рынке. Основные принципы — применение эффективных и инновационных тенденций. Поэтому именно среди продукции этого бренда можно встретить очень специфические растворы, которых не найти у других производителей. Примеры — это акриловая водно-дисперсионная грунтовка «Нортекс грунт Антисептик», которая отличается очень экономичным расходом, крайне доступной ценой и универсальностью применения, а также широкая серия уникальных огнебиозащитных средств защиты древесины.
  4. Ceresit (Германия). Один из наиболее востребованных европейских производителей всевозможных сухих смесей и строительных растворов. Качество этой продукции не вызывает никаких сомнений. Изготавливаться могут как непосредственно в Германии, та к и в России, Украине, но на конечный результат это не оказывает никакого влияния. Все пропорции четко выдержаны согласно единому правилу именно немецких технологов. Популярные грунтовки от этого производителя это:  битумная — BT 29 WB, силиконовая — СТ 15, грунтовка водно-дисперсионная глубокого проникновения универсального применения — СТ 17, акриловая — СТ 16.
  5. Vetonit. Еще один европейский бренд, производственные мощи которого расположены непосредственно в Германии, а также в странах СНГ. Многие потребители среди широкой линейки все продукции отмечают такие смеси, как МД 16, разработанную для обработки полов и Vetonit Dispersio, которая имеет универсальное назначение, вплоть до нанесения на сильно впитывающие материалы.

Важно! Еще стабильным спросом пользуются грунтовки таких компаний:

  • Bona;
  • Synteko;
  • Berger-Seidle;
  • Основит;
  • Belinka;
  • Pinotex;
  • Unis.

Какому именно бренду отдать предпочтение — решайте сами, исходя из требований строительства, объема предстоящих работ и обозначенного бюджета.

Нанесение грунта

Технология нанесения грунтовки не отличается сложностью. Правила очень просты, доступны даже тем, кто до сих пор не имел опыта в ремонтных и строительных работах. Заключаются они в следующем:

  1. Хорошо подготовьте основание:
    • удалите остатки покрытия, если производителем не указано, что допустимо нанесение на предыдущие слои окраски. При необходимости используйте шпатели, строительный фен, дрель и другие подходящие инструменты;
    • уберите весь строительный мусор, в том числе пыль с поверхности;
    • промойте основание водой и дождитесь полного высыхания.
  2. Убедитесь, что на улице или в помещении подходящий температурный режим — оптимальными показателями считаются +5-+20 °C.
  3. Размешайте грунтовочный раствор до однородной консистенции. Если купили готовую смесь — также немного ее перемешайте.
  4. Налейте в удобную плоскую малярную емкость-поддон.
  5. Окунайте кисть либо валик в смесь и промазывайте поверхность тонким слоем.
  6. Следите, чтобы грунтовка наносилась равномерно — нежелательно, чтобы оставались подтеки.
  7. Все труднодоступные стыки, углы обработайте красящими движениями с помощью малярной кисти.
  8. Дождитесь высыхания.
  9. Нанесите еще 1-2 слоя.

Важно! Специалисты рекомендуют, чтобы 1 слой грунтовки составлял 1-2 мм. Этого вполне достаточно для получения нужного результата.

Заключение

Теперь вы знаете все виды грунтовки, ее назначение и правила использования. Будьте внимательны при выборе подходящего раствора и аккуратно выполняйте саму отделку. При таком подходе вам не придется сомневаться в качестве работ, даже если вы выполняли их своими руками.

Полиуретановая грунтовка для металла: свойства и использование, виды грунтовых покрытий, а также их плюсы и минусы

Что такое полиуретановый грунт? Это химическое покрытие, которое используют для ремонта и защиты конструкций из стали, алюминия, черного и оцинкованного металла. Широкое распространение грунт нашел в машиностроительной, нефтеперерабатывающей, судостроительной и химической отраслях, поскольку останавливает коррозию, продлевает срок эксплуатации конструкций в агрессивной среде.

Им покрывают трубопроводы, мосты, конструкции в цехах, выставочных комплексах, аэропортах, стадионах, электростанциях. Наносить полиуретановый грунт можно на ржавую и пыльную поверхность. Хотя мы не рекомендуем это делать, поскольку срок защиты будет меньше, чем для предварительно очищенной поверхности.

Свойства и использование грунт-эмалей

Грунтовые смеси делят на однокомпонентные и двухкомпонентные. Они отличаются по составу и степени отверждения. Однокомпонентные покрытия делают на основе алкидной смолы. Двухкомпонентные — из полиуретана или акрила и эпоксидной смолы. Вязкая консистенция смеси проникает внутрь металлических пор, укрепляет поверхность, увеличивает адгезию.

Двухкомпонентную полиуретановую грунт-эмаль «Химтраст» рекомендуем для защиты поверхностей от химического, атмосферного воздействия. Такие составы высыхают быстрее однокомпонентных. Для металлических поверхностей в основном применяют двухкомпонентную грунт-эмаль. Она состоит из гидроксилсодержащей смолы и отвердителя на основе алифатического изоцианата.

Для больших объектов используют эпоксидные и полиуретановые грунтовки. Небольшие изделия покрывают алкидными составами.

Для примера рассмотрим также антикоррозийную грунт-эмаль от «Химтраст». Это однокомпонентное покрытие, которое можно применять без предварительной грунтовки для стальных конструкций. Оно представляет собой суспензию из пигментов, антикоррозийных добавок в растворе фенолалкидной смолы.

Виды грунтовых покрытий

По составу грунтовки бывают адгезивными, акриловыми, эпоксидными, силиконовыми. Главная задача грунта — защитить металл от ржавчины. Дополнительные свойства определяются составом смеси.

  • Адгезивную используют, чтобы обеспечить лучшее сцепление с поверхностью, сделать шероховатый слой.
  • Акриловая подходит для нанесения на поверхность внутри жилых помещений, потому что не имеет запаха и быстро высыхает.
  • Эпоксидная проникает в поры материала, защищает поверхность от агрессивных химических соединений.
  • Силиконовая нужна там, где повышена влажность. Например, на стадионах, в бассейнах.

По степени проникновения покрытие бывает обыкновенным или глубоким, способным заполнять поры материала.

Также оно может быть антисептическим — защищать от грибка и плесени. Или же обладать изолирующим эффектом — ограждать металл от разрушающего влияния химических средств и агрессивной среды. Грунт бывает адгезионным — служит связующим между поверхностями.

Преимущества полиуретанового грунта

Свойства полиуретанового грунта позволяют защитить металлическую поверхность любого типа и продлить срок ее службы.

  • Многофункциональность. Грунт подходит для внешней или внутренней отделки. Не важно, речь идет о кровле сложной конструкции над спортивным стадионом или трубах внутри жилого дома.
  • Гибкость. Грунтовка защищает эластичный или жесткий металл. Ей также покрывают рулонный тонколистовой материал.
  • Легкость нанесения. Работать с полиуретановой грунтовкой можно без предварительной подготовки. Наносить состав разрешается поверх ржавчины.
  • Адгезионность и антикоррозийность. Грунт проникает в поры изделия, улучшает адгезию, подходит для поверхностей, впитывающих влагу, защищает от коррозии.
  • Экономичность. Расход полиуретановой грунт-эмали составляет от 80 до 100 граммов при толщине 40 мкм на 1м2. Для сравнения: водно-дисперсионные грунтовки расходуют до килограмма смеси на метр.
  • Скорость высыхания. Грунт-эмаль полиуретановая «Химтраст» при +10 ⁰С сохнет 40 минут (от пыли) и два часа, когда речь идет о межслойной выдержке. При +35 ⁰С — 12 минут (от пыли) и 30 минут при межслойной выдержке.

Недостатки полиуретанового покрытия

Одним из главных неудобств в работе с грунтом считают особенности его нанесения. В строительстве применяют традиционное, комбинированное или безвоздушное распыление. Традиционный способ — нанесение грунтовки с помощью сжатого воздуха через краскопульт. Потери материала при этом методе могут составить до 30 %. Чтобы сократить их, рекомендуем пользоваться распылителем высокого давления или безвоздушным методом. Так можно контролировать количество наносимого материала и угол распределения.

Стоит отметить относительно высокую цену полиуретанового грунта в отличие от антикоррозийных, алкидных и модифицированных алкидных смол.

Как наносить полиуретановый грунт

Чтобы нанести полиуретановую грунтовку, нужно очистить металл от пыли, грязи, жира. Это можно сделать с помощью пескоструйной обработки или щетки. Важно, чтобы на металле не было зазубрин, трещин, острых углов. Для их устранения нужно воспользоваться шлифовальными инструментами. Устранять неровности круговыми движениями. Для обезжиривания подойдут распылители: бензин, спирт, ксилол.

Перед нанесением двухкомпонентную грунт-эмаль нужно подготовить. Для этого перемешать основу (компонент А), затем добавить отвердитель (компонент Б) в соответствии с инструкцией.

После этого подобрать инструменты для нанесения грунтовки. Это может быть валик, кисть, краскопульт. Для равномерного слоя и экономного расхода лучше применять установки безвоздушного напыления. При работе с кистью и валиком расход материала составит более 100 г/м2.

Зависимость расхода грунтовки от толщины покрытия

Рекомендуемая толщина покрытия Теоретический расход
сухой мокрой
20 мкм 30 мкм 40-50 г/м2
40 мкм 60 мкм 80-100 г/м2
60 мкм 90 мкм 140-160 г/м2

Работу с полиуретановым грунтом нужно проводить при температуре не ниже +10 ⁰С.

Вывод

Полиуретановая грунт-эмаль по металлу обладает адгезионными, антикоррозийными свойствами. Защищает даже ржавую поверхность, подходит для использования внутри помещения, а также в открытых пространствах. Продлевает срок эксплуатации гибких и жестких металлов. Расход материала можно сократить за счет использования безвоздушного способа нанесения.

Как выбрать грунтовку: состав, свойства

Представьте себе ситуацию: вы сделали ремонт, наконец-то решили отдохнуть в обновленной квартире, но проснувшись поутру внезапно увидели, что все обои лежат на полу, краска осыпалась, штукатурка обвалилась, а кот в шоке забился под кровать. Почему это произошло? Потому что вы либо совсем не использовали грунтовку во время ремонта, либо использовали покрытие низкого качества или неправильного назначения.

Чтобы застраховать себя от форс-мажоров, необходимо правильно выбрать грунтовку для строительных работ. Если вы еще не знаете как это сделать — мы вам поможем.

Что такое грунтовка и для чего она нужна

Грунтовка — это специальное жидкое покрытие для поверхностей, образующее особую пленку, придающую поверхности необходимые качества. Грунтовки используются для подготовительных работ перед облицовкой стен, потолков и т. д. Рассмотрим основные свойства грунтовок.

— Увеличение сцепления отделочных материалов с поверхностью — это основная функция грунтовки. Состав не только закрывает микротрещины на стенах, которые способствуют возникновению воздушных пузырьков под обоями или штукатуркой, но и своими «липкими» свойствами позволяет более качественно наносить штукатурку или клеить обои. Также грунтовка препятствует излишнему проникновению влаги в поверхность, поэтому если предварительно промазать ею стены, то расход, например, обойного клея, значительно снизится.

— Грунтовка выполняет функцию импровизированной стяжки для различных поверхностей, в том числе непрочных оснований под отделку. Если вы не уверены, например, в качестве штукатурки, то лучше покрыть ее плотным слоем грунтовки для упрочнения. Для пористых поверхностей можно использовать специальные грунтовки глубокого проникновения, которые надежно схватят покрытие.

— Благодаря специальным добавкам в грунтовки, поверхности после покрытия приобретают водоотталкивающие свойства, а также становятся устойчивыми к воздействию грибков и микроорганизмов.

Что касается типов грунтовки, то они различаются также в зависимости от того, на какую поверхность будут наноситься, поэтому учитывайте, что, например, покрытие для металла не подойдет для гипсокартона.

Грунтовки по металлу препятствуют возникновению коррозии, грунтовки по дереву рассчитаны на противодействие гниению и возникновению грибков, грунтовки для минеральных оснований помогают улучшить финишный слой при обработке поверхности (штукатурка, шпаклевка, краска и прочее).

Виды грунтовок по составу

Современный рынок предлагает очень много видов грунтовок, в основе которых лежат разные вещества. Такой выбор помогает подобрать состав для любых видов работ, в зависимости от типа обрабатываемого материала.

  • Акриловые грунтовки считаются самыми универсальными и удобными в работе с самыми разными материалами. Ими покрывают как обычную штукатурку, так и разные виды кирпичей, деревянные поверхности, ДСП и ДВП, бетонные стены и многое другое. Грунтовка сохнет быстро, достаточно глубоко проникает в поверхность и не имеет ярко выраженного запаха, что делает ее идеальной для использования в жилых помещениях. Не подходит для металлических поверхностей, т. к. со временем на них может возникнуть ржавчина.
  • Алкидные. Применяются для обработки деревянных поверхностей. Из-за свойств грунтовки дерево после промазывания немного разбухает, что делает его поверхность идеальным для сцепки с любыми материалами — от обоев до цементных смесей. Сохнут алкидные немного дольше акриловых — до 15 часов (и это один слой). В состав таких грунтовок входят специальные добавки, не позволяющие появляться грибку и плесени.
  • Эпоксидные грунтовки. Применяются, в основном, для обработки металлических поверхностей и бетонных стен. В первом случае они защитят металл от появления ржавчины, во втором обеспечат лучшее сцепление отделочных материалов с бетоном.
  • Кремнийорганические грунтовки применяются для обработки поверхностей, которые будут подвергаться воздействию высоких температур. Они способны выдерживать нагрев до 600°С, что делает их незаменимыми в промышленном производстве.
  • Силан-силоксановые грунтовки применяются для обработки финишных материалов с целью пресечения образования на них плесени и грибка. Подходят даже в том случае, если поверхность уже поражена микроорганизмами.
  • Глифталевые. Применяются для работы с металлическими поверхностями с последующей обработкой эмалевыми красками и схожими материалами. Не подходят для помещений с высокой влажностью.
  • Перхлорвиниловые грунтовки подходят для бетонных, металлических поверхностей, а также для обработки штукатурки всех типов. Не подходят для обработки внутри зданий и жилых помещений из-за того, что крайне токсичны. После покрытия на такую грунтовку наносится поливинилацетатная краска, которая защищает поверхность от коррозии и погодных воздействий.
  • Поливинилацетатные грунтовки производятся на синтетической основе. Включают в свой состав латекс или дисперсию на базе поливинилацетата. Также подходят для обработки поливинилацетатной краской, причем существенно снижают ее расход.
  • Фенольные грунтовки. Изготовлены на основе формальдегидных смол и других пигментов, что делает их достаточно токсичными. Не подходят для обработки внутри жилых помещений. С помощью такой грунтовки обрабатывают металлические поверхности и деревянные полы.
  • Полистирольные грунтовки применяются только для наружной отделки. Ими обрабатывают оштукатуренные стены или деревянные полы, которые открыты для погодных воздействий (веранды, беседки и т. д.).

Существуют также универсальные грунтовки, подходящие для обработки любых поверхностей. Во многих случаях это будет не идеальный подход, но если от поверхности не требуется каких-то особых качеств, то можно смело использовать такой вариант. Только учитывайте фактор безопасности и внимательно читайте про токсичность таких жидкостей.

Свойства грунтовок

У каждой грунтовки есть свои особые свойства, которые помогают в обработке специфических поверхностей.

— Грунтовки глубокого проникновения. Если видите перед собой пористую, рыхлую или любую другую поверхность, которая будет впитывать в себя жидкость как губка, необходимо выбрать грунтовку, глубоко проникающую в материал. Это значительно укрепит его и поможет сократить расход финишного материала, например краски, которая в противном случае начнет впитываться в поверхность в огромных количествах. Также хорошо подходит для обработки поверхностей, на которые будут клеиться обои.

— Антибактериальные грунтовки хороши к применению в ванных комнатах и санузлах. Они обладают водоотталкивающими свойствами и препятствуют возникновению грибка в местах с повышенной влажностью. Адгезия в таких грунтовках настолько высока, что материал вроде плиточного клея намертво цепляется к стене, поэтому в дальнейшем снижается риск возникновения трещин, где могут завестись злобные зубастые микробы. Работать такой грунтовкой лучше в несколько слоев для эффекта.

— Антикоррозионные грунтовки. Как можно понять из названия, препятствуют окислению металлов.

— Бесконтактные грунтовки. Их еще называют адгезивными. Иногда случается, что обрабатываемая поверхность настолько гладкая, что за нее не берется ни один материал, даже большинство видов грунтовок. Поверхность почти не впитывает жидкости, не имеет необходимой пористости, чтобы за нее схватилась штукатурка или обои.

Бесконтактная грунтовка призвана исправить эти недочеты. В ее состав входят маленькие песчинки кварца, поэтому после обработки стена становится шероховатой и на нее можно спокойно клеить обои или наносить шпаклевку.

Факторы, влияющие на выбор грунтовки

Перед выбором грунтовки изучите обрабатываемую поверхность, ее материал, есть ли составные конструкции (например, состоящие из дерева и металла, которые необходимо в будущем покрасить полностью).

Проверьте состояние покрытия. Если стена слишком рыхлая или пористая, то она заберет в себя намного больше грунтовки, а это не только повышенный расход средства, но и выбор в пользу определенных составов.

Учитывайте вид слоя, которым будет покрываться грунтовка.

Оцените условия в самом помещении. Предполагается ли повышенная влажность или же влияние низких и высоких температур.

Прикиньте примерный расход грунтовки. На это повлияет и способ нанесения. Например, промазывание стен или любых других поверхностей кистью очень трудоемкий процесс, но так можно неплохо сэкономить. Если вы решили поработать валиком, то приготовьтесь к большому расходу. Выгоднее всего наносить грунтовку пульверизатором.

Заключение

Выбор грунтовки напрямую влияет на финальный результат ваших стараний. От ее качества и правильно подобранных свойств зависит толщина вашего кошелька, ведь при ошибке есть риск, что в скором времени оштукатуренные стены вздуются, обои отвалятся, а настроение окончательно испортится.

Рейтинг статьи:

 рейтинг: 5  голосов: 3 

Грунтовка для авто виды свойства и способы применения

Если строители добросовестно выложили фундамент, то строение будет надежным и прослужит не один десяток лет. Что же касается автомобилей, то грунтовка для автомобиля – это тоже своеобразный фундамент для последующей покраски и надежность защиты от коррозии металла. Владелец машины, который хочет получить качественное лакокрасочное покрытие, никогда не экономит на грунтовке, потому что она является основой долговечности.

Что такое грунтовка для автомобилей?

Эпоксидный двухкомпонентный грунт Güntex 2K EPOXY FILLER 231

Грунтовка подразумевает целую серию продуктов, предназначенных для нанесения на подготовленную поверхность кузова автомобиля. Их подразделяют на три типа:

  1. Эпоксидная грунтовка.
  2. Праймер или грунт-выравниватель.
  3. Герметики.

Эпоксидная грунтовка имеет плотную структуру и потому водостойка. Ее используют как защиту от окисления. Для нанесения на поверхность кузова грунтовку соединяют с отвердителем согласно инструкции. Наносят один-два слоя с помощью краскопульта. Есть еще одна веская причина, почему эпоксидку наносят именно первым слоем – это отличная адгезия с металлом. Она будет служить хорошей основой для нанесения последующих слоев.

Грунтовка автомобильная наносится и другим образом: на голый металл наносится наполнитель, затем несколько слоев автогрунтовки, которые шлифуются каждый и только потом наносится герметик.
Эпоксидная грунтовка имеет замечательное качество – ее не нужно шлифовать после нанесения. Однако если будут обнаружены дефекты в покраске, то небольшие потеки можно устранить мелкозернистой шлифовальной бумагой.

[goo1]

Качественный грунт стоит недешево, но экономия может привести к тому, что придется покраску повторять. Потому лучше сразу выбрать наиболее подходящий высококачественный продукт.
Основная масса недорогих грунтовок через какое-то время дает усадку, и все огрехи на поверхности автомобиля проявляются. Этой ошибкой зачастую грешат неопытные мастера, и в результате им приходится восстанавливать поврежденные участки. А это дополнительные затраты как финансовые, так и временные.

Виды грунтовочных составов для автомобилей

Грунтовка по металлу автомобильная обладает сильнейшим сцеплением с поверхностью, предохраняя ее от коррозии, хотя толщина слоя всего лишь 15-20 мкм. От того, каким образом она воздействует на металл, грунтовку можно подразделить на виды:

  • пассивирующие грунтовки, содержащие хроматы некоторых металлов и др. вещества, делают поверхность пассивной к воздействию влаги. К ним относятся ГФ-031, ГФ-017 и другие. Например, свинцово-суричной грунтовкой пользуются для защиты от коррозии таких частей кузова, как днище и крылья;
  • грунтовки с инертными частицами, которые защитного действия не оказывают, а механически препятствуют проникновению влаги. Это такая грунтовка, которую часто используют для мелкого ремонта ГФ-21, а также ФЛ-ОЗК;

Фосфатирующий грунт ВЛ-02

  • протекторные грунтовочные смеси – содержат пыль таких металлов, как алюминий, цинк, свинец, имеющую меньший, чем у железа потенциал. Это значит, что при повреждениях грунтовка с такой пылью первой возьмет на себя удар агрессивных веществ, то есть ведет себя по отношению к металлу, как протектор. Примером может служить протекторная грунтовка ЭП-057, представляющая собой суспензию из эпоксидной смолы и порошка цинка;
  • фосфатирующие автомобильные грунтовки – содержат в себе фосфорную кислоту, которая при взаимодействии с металлом образует труднорастворимые фосфаты. Создаваемый прочный слой имеет хорошую адгезию, несмотря на то, что толщина его самая минимальная среди всех грунтовок – 8-12 мкм. К ним относятся такие грунтовки, как ВЛ-02, ВЛ-08, ВЛ-023, ВЛ-025. Такие грунтовки проникают в металл на глубину до 0,05 мкм, увеличивая тем самым сцепление с металлом. После их нанесения сразу можно наносить вторичный слой грунта.
  • грунтовка-модификатор ржавчины наносится прямо на места коррозии металла без предварительного их удаления. Грунт антикоррозийный для авто, преобразовывая ржавчину со своими компонентами, создает на поверхности прочную защитную пленку. Наносят его при температуре не ниже +15 градусов в два слоя кистью или при помощи распыления.

[goo2]

Грунтовки для автомобилей еще подразделяют на:

  • днокомпонентные, которые не содержат отвердителей. За счет этого они довольно долго сохнут и потому используются очень редко.
  • двухкомпонентные грунты – в их состав входят отвердители, и поверхности, обработанные ими, высыхают за сутки. Используются наиболее часто.
  • спиртовые грунты высыхают всего лишь за час благодаря своему составу. Используют их там, где другие виды грунтов применять просто нет смысла. Они бывают твердые и мягкие. Первые шлифуются с трудом, но они более устойчивы. Тогда как мягкие грунты обрабатываются легко, но через время дают усадку и лакокрасочное покрытие может быть повреждено.

Вывод: целесообразно применять твердые двухкомпонентные грунтовочные составы, так как они являются наиболее качественными.

Как грунтуется кузов в автосервисе?

Хорошие автосервисы перед покраской автомобиля наносят на его поверхность несколько видов грунта. Сначала используется кислотный грунт для авто или любая из фосфатирующих грунтовок, которые могут обеспечить наилучшую адгезию. Состав первичного грунта наносят на очищенную и обезжиренную поверхность кузова и равномерно распределяют. Шлифовка не требуется.

Предостережение: будьте осторожны при работе с фосфатирующими и кислотными грунтовками! При недостаточном проветривании можно получить химическое отравление.

Далее укладывают вторичный грунт в два-три слоя. Скорее всего, это двухкомпонентный твердый или мягкий грунт. Им хорошо скрываются мелкие изъяны поверхности. Каждый слой наносится через 5-10 минут. В мастерских, где есть профессионалы высокого уровня, применяют в целях экономии времени грунты, не требующие шлифовки.
При наличии идеально ровной поверхности металла в качестве вторичного грунта можно применять состав, дающий глянцевую поверхность без шлифования. Чтобы ему высохнуть, достаточно 15-20 минут и можно наносить финишную краску.

[goo3]

Как правильно выбрать и нанести грунтовку

При выборе грунта всегда проверяйте срок годности. Старайтесь использовать все продукты одного производителя, так как в противном случае они могут не совместиться и испортить всю вашу работу. И самое важное: отдавайте предпочтение проверенным фирмам.

На каждом продукте есть инструкция к применению, где указывается, сколько сохнет автомобильная грунтовка. Наносите слои, соблюдая эти сроки на хорошо подготовленную поверхность. Для выравнивания слоев грунтовки используйте шлифовальную бумагу с разным размером зерна. Ошибки шлифования устраняют нанесением грунтовки-выравнивателя более густой консистенции. Но заменять шпатлевку автомобильную грунтом нельзя. Грунт может справиться только с мелкими неровностями в отличие от шпатлевки.

Чтобы слои грунтовки и краски не смешались между собой, применяется автогерметик. Он хорошо защищает грунт от растворяющих веществ используемой краски, улучшает сцепление между слоями и делает слои однородными. Именно его применение отличает профессиональную покраску от простой малярной работы.

[ya_bo]

Грунтовка по металлу, ее характеристики, применение, виды

В современно мире существует большое количество материалов, которые используются для защиты от появления коррозии. Она покрывают металлическую поверхность тонким слоем пленки, которая не дает железу и другими видам металлов окисляться. Многие виды веществ против коррозии наносятся непосредственно перед лакокрасочными покрытиями. Одним из таких средств является грунт по металлу.

Характеристики грунтовки по металлу

Грунтовка по металлу представляет собой специализированный раствор, который наносится на металлическую поверхность для ее выравнивания и для защиты ее от коррозии. Данный материал применяют для обработки металлических поверхностей и на производственных предприятиях, и в быту. Грунтовка наносится на поверхность любого металла и образует тонкую защитную пленку, которая обладает устойчивостью к влаге и перепадам температур.

Важно: Во время использования данного материала необходимо узнать, каким является расход грунтовки по металлу. В среднем он составляет 100 граммов на метр квадратный.

Грунтовка по металлу в своем составе имеет специальные вещества, которые глубоко проникают в структуру любого металла и препятствуют его окислению. Грунтовка подходит для нанесения на любые металлические поверхности. Ее очень часто используют для проведения качественных лакокрасочных работ.

В настоящее время производится большое количество грунтовок, предназначенных для обработки металлических изделий. На сегодняшний день это один из самых эффективных методов защиты от появления коррозии.

Таблица. Технические требования согласно ГОСТ
Наименование показателяЗначениеМетод испытания
Органоразбавляемые грунтовкиВодно-дисперсионные грунтовки
Показатели грунтовки.
1 Массовая доля нелетучих веществ, %, не менее 13,0 48,0 По ГОСТ 17537
2 Условная вязкость при температуре (20±0,5) °С по вискозиметру типа ВЗ-246, с 13 — 180 30 — 180 По ГОСТ 8420
3 Время высыхания: для грунтовок естественной сушки до степени 3 при температуре (20±2) °С, ч, не более: По ГОСТ 19007 и 9.4 настоящего стандарта
для эпоксидных грунтовок 36
для всех остальных 24 5
для грунтовок горячей сушки, ч, не более 4 2
4 Жизнеспособность (срок годности) после смешения компонентов при температуре (20±2) °С, ч, не менее: Не определяют По ГОСТ 27271
для эпоксидных грунтовок 4
для всех остальных 6
5 Класс и подкласс опасности (температура вспышки в закрытом тигле, °С): По ГОСТ 19433 и 9. 5 настоящего стандарта
3.1 Менее минус 18 Менее минус 18
3.2 Минус 18 и более, но менее 23 Минус 18 и более, но менее 23
3.3 23 и более, но менее 61 23 и более, но менее 61
9.1 Более 61, но менее 90 Более 61, но менее 90
Показатели покрытия: 6 Внешний вид покрытия После высыхания грунтовка должна образовывать однородную, без кратеров, пор и морщин поверхность После высыхания грунтовка должна образовывать однородную, без кратеров, пор и морщин поверхность По 9.6 настоящего стандарта
7 Адгезия покрытия, баллы, не более 2 2 По ГОСТ 15140
8 Эластичность пленки при изгибе, мм, не более 3 3 По ГОСТ 6806
9 Стойкость покрытия к статическому воздействию при температуре (20+2) °С, ч, не менее- По ГОСТ 9. 403, метод А и 9.7 настоящего стандарта
воды 24 24
раствора хлористого натрия с массовой долей 3 % 8 8
10 Стойкость покрытия к статическому воздействию химически агрессивных сред при температуре (20 ± 2) °С, ч, не менее 2 2 По ГОСТ 9403, метод А и 9.8 настоящего стандарта

Грунтовка для покраски металла

Покраска метала грунтовкой является достаточно сложным процессом. Процедуру необходимо проводить по правилам, которые прописывает каждый производитель на упаковке материала. Процесс не занимает много времени.

Он состоит из следующих этапов:

  • Подготовка поверхности

На данном этапе осуществляется очистка поверхности от всевозможных загрязнений. Это нужно, чтобы грунтовка покрыла металл и способствовала наилучшей его адгезии с лакокрасочным материалом. После устранения крупных загрязнений необходимо промыть поверхность и дать ей высохнуть. После этого нужно поработать наждачной бумагой. Она поможет выровнять поверхность металла для лучшего нанесения состава грунта.

  • Нанесение грунтовки

Наносить грунтовочный материал на поверхность металлического изделия необходимо тонким слоем. При необходимости можно использовать несколько слоев нанесения. Их количество зависит от качества металлического материала. В некоторых случаях окрашиванию подвергаются старые изделия, которые уже имеют следы образования ржавчины. Структура метала становится неоднородной. В этом случае наносить вещество необходимо в несколько слоев.

Применение грунтовки по металлу

Грунтовку по металлу рекомендуется использовать при проведении лакокрасочных работ металлических изделий. Она служит защитой от коррозии. Ее можно наносить не только под лакокрасочные изделия, но и как самостоятельный продукт. Она таким образом может использоваться тогда, когда нет необходимости делать металлическую поверхность более привлекательной с эстетической точки зрения.

Грунтовка служит для:

  • защиты металла от коррозии,
  • повышения уровня прочности металлического покрытия,
  • устойчивости металлов к перепадам температур,
  • продления срока использования того или иного металлического изделия.

Виды грунтовок по металлу

Сегодня имеется большое количество видов грунтовки по металлу.

Они представлены следующими категориями:

  • Фосфатирующая грунтовка

Данная грунтовка относится к разряду двухкомпонентных. Она состоит из оротфосфорной кислоты и специального вещества для ее разбавления. Ее можно использовать для покрытия практически всех типов металлических поверхностей.

  • Алкидная грунтовка

Данный вид грунтовки по металлу относится к разряду изолирующих. Она используется для защиты металлического изделия или поверхности от образования коррозии. В ее составе находятся наполнители, которые представлены железным суриком, цинковых белил и многих других вспомогательных компонентов.

  • Пассивирующая грунтовка по металлу

Данная грунтовка используется преимущественно для того, чтобы снизить электрохимические качества металлов.

  • Ингибирующая грунтовка

Данный вид грунтовки является уникальным. Она не образует на поверхности металла тонкую пленку. Она проникает в его структуру на молекулярном уровне и меняет его свойства. Благодаря этому металл становится более плотным и твердым.

  • Протекторная грунтовка для покрытия металла

В ее составе имеется смесь магния и цинка. Она предназначена для того, чтобы металл приобрел высокий уровень прочности. Металл становится более твердым, что не дает образовываться на его поверхности даже небольшим царапинам.

  • Грунтовка преобразователь

Она используется для того, чтобы устранять ржавчину. Она смешивается с элементами ржавчины и делает ее структуру более пористой. После этого налет легко удаляется.

Кварцевая грунтовка — состав, свойства и сфера применения.

— Farbe

Чтобы поверхность не тускнела и не растрескивалась, ее необходимо обрабатывать специальными средствами. Самым эффективным средством служит кварцевая грунтовка.

Этот уникальный материал хорош тем, что упрочняет свойства поверхности, а также разглаживает ее. После чего на грунтовку можно наносить различные краски, либо штукатурки.

В состав кварцевой грунтовки входят сухие строительные компоненты. Ключевым наполнителем здесь являются органические материалы с включением химического зерна, а также кварцевой крошки. Данные компоненты отвечают за прочность и позволят поверхности сохранить свои технологические и конструктивные особенности на долгие годы.

К плюсам использования кварцевой грунтовки относится то, что при взаимодействии кварцевого зерна с поверхностью уменьшается время высыхания материала. Также кварцевое зерно очень устойчиво к атмосферному давлению. Таким образом, такие интересные свойства материала увеличивают спрос на него. Кварцевую грунтовку можно применять не только для дальнейшего обрабатывания стен, полов и других поверхностей, но и для придания им прочности и твердости.

Из вышеизложенного следует, что данный материал подходит для обработки как бетонных поверхностей, так и металлических.

Для того чтобы взаимодействие с поверхностью было наиболее эффективным, ее требуется обезжирить. Ведь излишняя влажность, наличие пыли, жир нарушают конструктивные свойства кварцевой грунтовки.

К общим свойствам и достоинствам этого материала можно отнести следующие:
  • Сильную влагостойкость (при условии обезжиривания поверхности).
  • Достаточную механическую стойкость при трении с другими материалами и долгий срок службы.
  • Хорошие свойства сцепления с основой.
  • Создание необходимой шероховатой поверхности.
  • Наличие возможности наносить различные виды штукатурки на материал.

Для сохранения свойств грунтовки, нужно соблюдать условия хранения данного материала.

Очень важно обеспечить качественную подготовку поверхности. Она заключается в очищении поверхности от различных включений, краски, камней, пыли. Бывает так, что поверхность содержит как впадины, так и выпуклые неровности. Все это тщательно необходимо выровнять. После уже можно переходить к процессу подготовки рабочей смеси. Во всех магазинах данный материал обычно поставляется в готовом виде, но за счет химических свойств вещества в грунтовке абсорбируются и их необходимо друг с другом смешивать. Существует смесь и в сухом виде, но она, как правило, менее качественная и более затратная по времени приготовления и вспомогательным компонентам.

В зависимости от обрабатываемой поверхности (бетон, металл, дерево) меняется расход грунтовочного материала. Это обусловлено наличием пористости материалов: металл, к примеру, фактически ей не обладает. Сама смесь готовой грунтовки имеет однородную консистенцию, без комочков, легко наносится при помощи кисти или специального валика. Преимуществом является то, что высыхает грунтовая смесь приблизительно за три часа.

Приобрести этот вид грунтовки можно на нашем сайте в разделе «Грунтовки». Кварцевые грунтовки выпускают разнообразных оттенков. Одни из них белые и предназначены для отделки штукатуркой и дальнейшего окрашивания. Также выпускают грунтовки цветные, которые служат для отделки наружной части здания. Через них, как правило, основание стен не просвечивается и дальнейшее окрашивание не требуется.

Итак, кварцевые грунтовки идеально подойдут для работы на любых поверхностях и позволяют проникать на любую глубину. Этот материал удобен в обработке бетонных, кирпичных, стеклянных и других строительных поверхностей. А также кварцевые грунтовки обеспечивают не только контактные свойства материалов, но и их защиту.

Задать вопрос эксперту

Addgene: Protocol – Как разработать праймеры

Дизайн праймеров для ПЦР

Олигонуклеотидные праймеры необходимы при проведении реакции ПЦР. Необходимо разработать праймеры, комплементарные матричной области ДНК. Они синтезируются химически путем соединения нуклеотидов вместе. Нужно избирательно блокировать и повторно блокировать реактивные группы на нуклеотиде при добавлении нуклеотида по одному. Основное свойство праймеров состоит в том, что они должны соответствовать последовательностям молекулы-матрицы (должны быть комплементарны цепи матрицы).Однако праймеры не обязательно должны полностью соответствовать цепи матрицы; однако важно, чтобы 3′-конец праймера полностью соответствовал цепи матричной ДНК, чтобы можно было продолжить удлинение. Обычно на 3′-конце используется гуанин или цитозин, а 5′-конец праймера обычно имеет участки в несколько нуклеотидов. Кроме того, оба 3′-конца гибридизированных праймеров должны указывать друг на друга.

Размер грунтовки также очень важен. Короткие праймеры в основном используются для амплификации небольшого простого фрагмента ДНК.С другой стороны, длинный праймер используется для амплификации образца геномной ДНК эукариот. Однако праймер не должен быть слишком длинным (> 30-мерных праймеров) или слишком коротким. Короткие праймеры дают неточный, неспецифический продукт амплификации ДНК, а длинные праймеры приводят к более медленной скорости гибридизации. В среднем фрагмент ДНК, который необходимо амплифицировать, должен иметь размер в пределах 1-10 кБ.

Структура грунтовки должна быть относительно простой и не содержать внутренней вторичной структуры во избежание внутренней складчатости.Также необходимо избегать отжига праймеров, который создает димеры праймеров и нарушает процесс амплификации. При разработке, если вы не знаете, какой нуклеотид поместить в определенное положение внутри праймера, можно включить более одного нуклеотида в это положение, называемое смешанным сайтом. Можно также использовать молекулярную вставку на основе нуклеотидов (инозин) вместо обычного нуклеотида для более широких возможностей спаривания.

Принимая во внимание приведенную выше информацию, грунтовки обычно должны обладать следующими свойствами:

  • Длина 18-24 основания
  • 40-60% содержание G/C
  • Начало и конец с 1-2 парами G/C
  • Температура плавления (Tпл) 50-60°С
  • Пары праймеров должны иметь Tm в пределах 5°C друг от друга
  • Пары праймеров не должны иметь комплементарных областей

    Примечание: Если вы будете включать сайт рестрикции на 5’-конце праймера, обратите внимание, что «зажим» из 3–6 пар оснований должен быть добавлен выше, чтобы фермент мог эффективно расщеплять (например,грамм. GCGGCG-сайт рестрикции-ваша последовательность).

История версий OligoCalc

История версий калькулятора свойств олигонуклеотидов

Текущая версия доступна по адресу http://www.basic.northwestern.edu/biotools/OligoCalc.html

Версия 1.0 15.04.97 wakibbe Создан Oligo Calc с термодинамическим расчетом и выпущены два эмпирических расчета Tm

Версия 1.1 ???????? wakibbe Добавлена ​​функция отправки BLAST2

Версия 1.2 ????????? wakibbe Добавлен расчет флуоресцентных меток, функция «Поменять местами нити».

Версия 1.3 ???????? wakibbe Добавлена ​​функция формирования шпильки

Версия 2.0 25.10.99 Цин Цао Изменен Blast2, связанный с новым сайтом NLM NCBI. (Старый сайт был http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST/nph-newblast, новый сайт: http://www.ncbi.nlm.nih.gov/blast/blast.cgi

Версия 2.01 05/2000 Цин Цао Добавлен расчет самодополнительности

Версия 2. 01 08/2000 Qing Cao Отключено вычисление шпильки для IE 4.шпилька только для Netscape [работает для IE 5 и выше].

Версия 3.00 15.12.2000 wakibbe разделил объекты javascript на отдельные файлы. «очищенные» объекты и изолированные взаимодействия формы/объекта для использования в классе

Версия 3.01 от 19.12.2000 wakibbe исправления ошибок для IE

Версия 3.02 23/02/2002 Ошибка вычисления дополнения wakibbe, описанная Алексеем Мерцем [email protected], устранена

Версия 3.03 09.02.2004 wakibbe Добавлены функции совместимости для браузеров Safari и Mozilla

Версия 3.04 12.02.2004 wakibbe Снова изменена конфигурация BLAST

Версия 3.05 13.02.2004 wakibbe Изменена молекулярная масса для добавления монофосфата вместо вычитания пирофосфата (добавление 79,0 г/моль вместо вычитания 61,96)

Версия 3.06 14.02.2004 wakibbe Добавлены опции ssDNA/dsDNA/ssRNA/dsRNA

Версия 3.07 26.03.2004 wakibbe Расчет MW возвращен к старому методу и добавлены примечания в области формулы MW. Также изменены ссылки на рефераты статей на новые URL-адреса NCBI, добавлена ​​статья по термодинамике РНК в ссылки.

Версия 3.08 01.07.2004 wakibbe Изменены флуоресцентные метки для приема 5-дюймовых и 3-дюймовых меток. В списки добавлено много новых флуоресцентных тегов. Изменен способ расчета MW флуоресцентных меток. Массивные изменения во внешнем виде калькулятора. Интересно, кто-нибудь прокомментирует? Концентрации праймера и соли перемещены в область для ввода пользователем.

Версия 3.09 18.07.2006 wakibbe Уточнено обсуждение того, когда фактически используются различные уравнения.

Версия 3.10 25.09.2006 wakibbe Исправлена ​​ошибка расчета двухцепочечной молекулярной массы, обнаруженная Боррисом Демелером. Спасибо, Боррис!

Версия 3.11 10.01.2007 wakibbe Добавлено примечание и цитата о двухвалентных катионах. Добавлена ​​ссылка на скачивание исходного кода

Версия 3.12 28.01.2007 wakibbe Исправлена ​​опечатка «флуоресцентная», добавлены дополнительные ссылки для основных и скорректированных по соли расчетов для РНК.

Версия 3.13 29 января 2007 г. wakibbe Исправлена ​​давняя ошибка в коде шпильки/дополнительности, из-за которой код IUPAC ‘M’ не вычислялся должным образом.Сообщение Пола Уэйпера в марте 2005 года. Извините, Пол, что патч не был выпущен раньше! Отправлена ​​рукопись OligoCalc в веб-версию NAR. Всего примерно на семь лет позже, чем я должен был представить его.

Версия 3.14 19 марта 2007 г. wakibbe Переместил запись Usage Patterns из рукописи NAR на отдельную страницу (http://www.basic.northwestern.edu/biotools/OligoCalcUsage.html) и добавил таблицы стилей для этой страницы, страницы Usage Patterns. .

Версия 3.15 20 марта 2007 г. wakibbe Пункт входа Absorbance перемещен вверх в область входа, чтобы сделать его более очевидным.Убраны шпилька и выбор комплементарности.

Версия 3.16 21 марта 2007 г. wakibbe Заменен старый код «Проверки на самодополнение» вызовом сервера mfold в RPI.

Версия 3.17 21 марта 2007 г. wakibbe Переписал код BLAST так, чтобы он извлекал данные либо из кода «открывателя», либо из файла cookie.

Версия 3.18 21.03.2007 wakibbe Сделал код окна BLAST и код окна вызова mfold очень похожими, вынес некоторые функции в отдельный файл. Файлы cookie не работают с Safari.Отлично работает с Mozilla, IE, FireFox, Camino. Почему всегда есть один браузер, который усложняет задачу, и почему это никогда не бывает одним и тем же браузером?

Версия 3.19 22.03.2007 wakibbe Yike! Много жалоб! Добавил старый чек обратно, сохранил код с обращением к серверу mfold на RPI.

Версия 3.20 26.04.2007 wakibbe Удалены все метатеги и повторяющаяся информация о версии с главной страницы OligoCalc, изменен заголовок и два заголовка документации.

Версия 3.21 04.07.2007 wakibbe Добавлено цитирование Nucleic Acids Research, очищены и удалены некоторые детали, очищена контактная информация и раздел благодарности в конце главной страницы, а также исправлена ​​опечатка цитирования (изменен Proc.Нуклек Кислоты Res. до нуклеиновых кислот рез.).

Версия 3.22 12.03.2008 wakibbe Исправлена ​​давняя ошибка расчета ОП, доведенная до моего сведения Рэйчел Миттон-Фрай из Йельского университета.

Версия 3.23 15 мая 2008 г. wakibbe Изменен URL-адрес m-fold на последний URL-адрес, используемый веб-сервером m-fold Майкла Цукера. Мое внимание привлек Джереми Эдвардс из Центра медицинских наук Университета Нью-Мексико.

Версия 3.24 17.01.2009 wakibbe Добавлена ​​ссылка на русскоязычную версию Oligocalc, поддерживаемую Леонидом Валентовичем.

Версия 3.25 23.07.2009 wakibbe Исправлена ​​еще одна давняя ошибка, связанная с включением самолетов A260 для 3- и 5-футовых модификаций в расчеты OD. Об этом сообщила Кейт Либерман из Калифорнийского университета в Санта-Круз.

Версия 3.26 15/07/2010 wakibbe Добавлена ​​функция включения точности 0,01 градуса для олигонуклеотидов исследования SNP на основании запроса доктора Чжао Чена из MD Anderson. Ему было что сказать. Цитирую:

Привет, доктор Киббе,
 
Я попытался использовать программное обеспечение OligoCalc для расчета значений Tm ампликона плавления высокого разрешения.
проба.Это сработало отлично, особенно с помощью метода ближайшего соседа, который точно соответствовал
экспериментальное значение с помощью машины LightCycler от Roche. 
 
Но проблема в том, что поскольку HRM в большинстве случаев рассматривает генные мутации одной единственной пары оснований. Так
изменения Tm очень малы, обычно менее 1 градуса. Но ваше программное обеспечение не может предоставлять значения в
формат 80.ХХ. Таким образом, все мутации будут иметь один и тот же Tm.
 
Я думаю, что это лучшее, что я когда-либо пробовал. Но я надеюсь, что это программное обеспечение может улучшить разрешение, и это сделает его
можно использовать для HRM-анализа.Большое спасибо!
 
-------------------------------------------------- ------------------------
Чжао Чен, доктор философии.
Лаборатория молекулярной диагностики
Отделение гематопатологии
Онкологический центр доктора медицины Андерсона. Вставка 149
Центр медицинских наук Техасского университета в Хьюстоне
8515 Фаннин, НАО1.061а
Хьюстон, Техас 77054
 

Спасибо, доктор Чен!

Версия 3.27 30.12.2015 wakibbe Молекулярная масса BHQ-1 скорректирована в соответствии с данными масс-спектрометрии доктора Джека Лана из Beijing SBS Biotech. Молекулярная масса 3′-BHQ-1 была скорректирована с 538.от 49 до 554,49

И, конечно же, спасибо всем, кто использовал OligoCalc и отмечал ошибки или делал запросы!

Шаблоны использования OligoCalc

Шаблоны использования OligoCalc

С 1997 по 2006 год было совершено более 900 000 обращений к OligoCalc с почти 200 000 различных хостов. OligoCalc доступен по адресу http://basic.northwestern.edu/biotools/OligoCalc.html

.

Из-за долгой (относительно) истории OligoCalc мы смогли изучить веб-журналы (1) с 1998 по конец 2006 года (2) и отметить несколько интересных статистических данных.

  1. Google является реферером номер один, и после того, как OligoCalc поднялся на вершину рейтинга Google при поиске «Свойства олигонуклеотидов» или «Температура плавления олигонуклеотидов», трафик на сайт увеличился с 10 000 страниц в 2000 г. до почти 100 000 страниц в 2001 г. текущий уровень посещаемости около 200 000 страниц в год. Обратите внимание, что после загрузки страницы можно выполнять несколько расчетов олигонуклеотидов без перезагрузки.
  2. Браузерный трафик на страницах [запросы].Различные разновидности ОС Windows стабильно преобладали в большинстве на уровне 75–85 % в год, а в 2006 г. — 77,8 % [83,9 %. 13,94%] в 2006 г. В 2006 г. на долю неизвестных или неинтерпретируемых операционных систем (вероятно, роботов) приходилось 4,1% [0,8%], известных роботов — 2,6% [0,4%] трафика, а Unix, включая Linux, Solaris и HP-UX, — 1,0 % [1,0%]. Разбивая версии ОС Windows, мы видим, что большинство (82,5%) приходится на Windows XP, 14% — на Windows 2000 (не поддерживается с 2005 года) и 2% — на Windows 98.Остальные версии, включая ME, NT, Windows 95 и Windows CE, составляют оставшиеся 1,5% трафика.
  3. С точки зрения браузера, MSIE был браузером номер один, 75,1%, с явным большинством среди ОС Windows и удивительно большим числом (22%) среди пользователей Mac OS, учитывая, что MSIE для Mac не обновлялся с июня 2003 г. и полностью прекратил распространение в 2005 году. Для сравнения, Safari, встроенный браузер Mac OS, обрабатывает всего 53% трафика Mac OS, что намного меньше доли рынка, чем IE для Windows. Другие браузеры с разбивкой по общим страницам и страницам Mac OS включают Netscape с 4,6% [4,0%], Firefox с 16% [19,3%], Safari с 8,0% [52,9%], Mozilla с 1,3%, Opera с 0,8%, Konqueror на 0,2% и Camino на 0,2%. Остальной трафик был получен от роботов, включая Googlebot, Inktomi, Scooter, msnbot, webcrawler, ultraseek, с дополнительными 572 индивидуально идентифицированными агентами, составляющими почти 2% трафика.
  4. С точки зрения страны посетители из более чем 100 стран использовали OligoCalc в 2006 г., как было установлено обратным поиском в веб-журналах (3).

Каталожные номера

  1. Аналоговый анализатор веб-журналов с открытым исходным кодом ( http://www.analog.cx/ ) и программа разрешения DNS jdresolve ( http://www.jdrowell.com/archives/2000/01/new_home_for_jd.html ) были используется для анализа веб-журналов для OligoCalc.
  2. Результаты анализа веб-журнала для OligoCalc доступны по адресу http://basic.northwestern.edu/biotools/AllStatistics. html
  3. Результаты анализа веб-журнала OligoCalc за 2006 г. доступны по адресу http://www.basic.northwestern.edu/biotools/Statistics2006.html

PCR Primer Дизайн Советы — За Bench

Выберите страну / регион *

Выберите страну / regionUnited StatesCanadaAfghanistanAlbaniaAlgeriaAmerican SamoaAndorraAngolaAnguillaAntarcticaAntigua и BarbudaArgentinaArmeniaArubaAustraliaAustriaAzerbaijanBahamasBahrainBangladeshBarbadosBelarusBelgiumBelizeBeninBermudaBhutanBoliviaBosnia и HerzegovinaBotswanaBouvet IslandBrazilBritish Индийский океан TerritoryBrunei DarussalamBulgariaBurkina FasoBurundiCambodiaCameroonCape VerdeCayman IslandsCentral африканских RepublicChadChileChinaChristmas IslandCocos (Килинг) IslandsColombiaComorosCongoCongo, Демократическая Республика ofCook IslandsCosta РикаКот-д’ИвуарХорватияКубаКипрЧехияДанияДжибутиДоминикаДоминиканская РеспубликаВосточный ТиморЭквадорЕгипетЭль-СальвадорЭкваториальная ГвинеяЭритреяЭстонияЭфиопияФолклендские (Мальвинские) островаФарерские островаФиджиФинляндияПремьер Югославская Республика МакедонияФранцияФранцузская ГвианаФранцузская ПолинезияФранцузские Южные ТерриторииГабонГамбияГрузияГрузия raltarGreeceGreenlandGrenadaGuadeloupeGuamGuatemalaGuineaGuinea-BissauGuyanaHaitiHeard и McDonald IslandsHoly Престол (Ватикан) HondurasHong KongHungaryIcelandIndiaIndonesiaIran (Исламская Республика) IraqIrelandIsraelItalyJamaicaJapanJordanKazakstanKenyaKiribatiKorea, Корейские Народно-Демократической RepKorea, Республика ofKuwaitKyrgyzstanLao Народный Демократической RepLatviaLebanonLesothoLiberiaLibyan Arab JamahiriyaLiechtensteinLithuaniaLuxembourgMacauMadagascarMalawiMalaysiaMaldivesMaliMaltaMarshall IslandsMartiniqueMauritaniaMauritiusMayotteMexicoMicronesia, Федеративные StatesMoldova, Республика ofMonacoMongoliaMontserratMoroccoMozambiqueMyanmarNamibiaNauruNepalNetherlandsNetherlands AntillesNew CaledoniaNew ZealandNicaraguaNigerNigeriaNiueNorfolk IslandNorthern Mariana IslandsNorwayOmanPakistanPalauPanamaPapua Нового GuineaParaguayPeruPhilippinesPitcairnPolandPortugalPuerto RicoQatarReunionRomaniaRussian FederationRwandaSaint HelenaSaint Китс и НевисСент-ЛюсияСент-Пьер и МикелонСамоаСан-Ма rinoSao Томе и PrincipeSaudi ArabiaSenegalSeychellesSierra LeoneSingaporeSlovakiaSloveniaSolomon IslandsSomaliaSouth AfricaSpainSri LankaSth Georgia & Sth Sandwich Институт социальных Винсент и GrenadinesSudanSurinameSvalbard и Ян MayenSwazilandSwedenSwitzerlandSyrian Arab RepublicTaiwan, провинция ChinaTajikistanTanzania, Объединенная Республика ofThailandTogoTokelauTongaTrinidad и TobagoTunisiaTurkeyTurkmenistanTurks и Кайкос IslandsTuvaluUgandaUkraineUnited Арабские EmiratesUnited KingdomUruguayUS Малые отдаленные IslandsUzbekistanVanuatuVenezuelaVietnamVirgin острова (Британские) Виргинские острова (U . S.)Острова Уоллис и ФутунаЗападная СахараЙеменЮгославияЗамбияЗимбабве

Определение свойств олигонуклеотидов и разработка праймеров: критическая проверка предсказаний | Биоинформатика

Аннотация

Мотивация: Точное предсказание температуры плавления ( T m ), вторичной структуры и дизайна олигонуклеотидов определяют эффективность и успех экспериментов в молекулярной биологии. Наличие большого количества программного обеспечения и неосведомленность пользователей об их ограничениях ставит под угрозу точность и надежность прогнозов.

Результаты: Сравнительный анализ 56 модулей был выполнен для предсказания T m с использованием большого набора олигонуклеотидных последовательностей, охватывающих весь диапазон GC-содержания и длины. Модуль Allawi калькулятора ‘MELTING’, ближайший сосед (NN) калькулятора oligo (McLab), NN T m Расчет для Oligos (Biomath Calculator, Promega) и HYTHER предоставил наиболее точные T m предсказания. Также была предложена модель для расчета оптимальной температуры отжига с учетом уже опубликованных составов.Прогнозы вторичной структуры олигонуклеотидов показывают большое количество структур, в отличие от экспериментальных наблюдений. Из 11 оцениваемых инструментов разработки праймеров Primer 3 и WebPrimer показали лучшие результаты для шаблонов с высоким содержанием AT, Exon Primer для шаблонов с AT = GC и Primer Design Assistant, Primer3 и Primer Quest для шаблонов с высоким содержанием GC. Это исследование предоставляет пользователю оптимальный выбор для применения, увеличивая успех различных экспериментов, особенно тех, которые имеют высокую пропускную способность и сложные схемы анализа.

Контактное лицо: [email protected]

Дополнительная информация: Подробная информация об олигонуклеотидах и различных модулях предсказания T m , рассмотренных для исследования, представлена ​​в качестве дополнительной информации, доступной по адресу Биоинформатика онлайн.

ВВЕДЕНИЕ

Эксперименты в молекулярной биологии неизменно вращаются вокруг олигонуклеотидов, группы дезоксинуклеотидов. Некоторыми из методов, в которых олигонуклеотиды используются в качестве основного компонента, являются полимеразная цепная реакция (ПЦР), гибридизация, Саузерн-блоттинг, секвенирование и т. д.Возможно, наиболее универсальным методом, используемым сегодня, является ПЦР, с приложениями, включая амплификацию, клонирование, обнаружение мутаций, мутагенез и исследования полиморфизма длин рестрикционных фрагментов. Основными характеристиками олигонуклеотидов, определяющими эффективность и точность этих экспериментов, являются температура плавления ( T m ), вторичные структуры и дизайн праймера. Выбор неоптимальной последовательности или температуры может привести к усилению или обнаружению неправильных последовательностей.Эти характерные особенности олигонуклеотидов приобретают гораздо большее значение, когда мы переходим к дизайну с высокой пропускной способностью и к сложным анализам, таким как ДНК-микрочип и мультиплексная ПЦР, в которых используется много взаимодействующих олигонуклеотидов, поскольку затраты, связанные с каждой реакцией, огромны.

Несколько программ доступны как в коммерческих, так и в бесплатных Интернет-магазинах для определения свойств олигонуклеотидов и разработки праймеров. Для теоретической оценки T m олигонуклеотидов доступно большое количество компьютерных программ, основанных на различных методах, учитывающих широкий спектр параметров; число постоянно увеличивается.Методологии, принятые в программном обеспечении, можно в целом разделить на базовые, которые учитывают содержание %G+C для расчета T m (Marmur and Doty, 1962) (Wallace et al. ., 1979), с поправкой на соль (SA). ), который учитывает концентрацию соли (обычно концентрация Na + ) (Howley et al ., 1979) и модули ближайшего соседа (NN), которые рассчитывают T m с использованием известных параметров ДНК NN , учитывая концентрации солей и олигонуклеотидов (Breslauer et al ., 1986; Freier и др. ., 1986; Sugimoto и др. ., 1995, 1996; SantaLucia и др. ., 1996; Алави и Санта-Лючия, 1997 год; Санта-Лючия, 1998 год; Ся и др. , 1998). T m оценка различными программами приводит к огромным и существенным различиям, заставляя пользователей сомневаться в достоверности оценок. Помимо этого, большинство пользователей, по-видимому, не знают об ограничениях используемого ими программного обеспечения и используемого метода, что еще больше снижает точность и надежность.

Другим параметром первостепенной важности, который рассматривается для качественной оценки олигонуклеотида, является образование вторичных структур, включающих собственные димеры, шпильки и кросс-димеры с другими взаимодействующими олигонуклеотидами. Хорошо документировано, что эта характеристика нуклеиновых кислот влияет на связывание олигонуклеотидов (Gamper et al. , 1987). Предсказание вторичной структуры для любой заданной последовательности основано на алгоритмах минимизации энергии, и вероятность правильного предсказания довольно мала из-за ограничений математической модели и неопределенностей термодинамических параметров, используемых в этих методах (Донг и др. ., 2001). Вторичная структура ДНК-мишени, с которой связывается олигонуклеотид, также вызывает беспокойство (Федорова и др. , 1992) и требует должного внимания.

Дизайн праймера принципиально важен для всех исследований и методов обнаружения на основе ПЦР. Хотя за последние годы было проведено много исследований по разработке праймеров, все еще отсутствует полное понимание различных факторов, влияющих на амплификацию и выход продукта. Следовательно, всегда желательно учитывать все известные параметры (Robertson and Walsh-Weller, 1998) и иметь программное обеспечение, которое использует этот целостный подход, чтобы предоставить нам наилучшую возможную пару праймеров для амплификации ДНК-мишени.Значительное количество неудач амплификации может быть связано с неправильным дизайном праймеров, что требует определения лучшего программного обеспечения для проектирования праймеров среди доступных.

Это исследование разделено на три части: во-первых, определение наилучшего калькулятора свойств олигонуклеотидов, который будет предсказывать T m с наименьшим отклонением, который можно использовать при расчете оптимальной температуры отжига для ПЦР-амплификации; во-вторых, оценка прогнозов вторичной структуры; и в-третьих, проверка эффективности программного обеспечения для разработки праймеров и определение лучшего из них.

МЕТОДЫ

Исследования термического плавления

Используемые олигонуклеотиды

были либо получены от Sigma Genosys, либо синтезированы внутри компании (в Центре геномного применения) на высокопроизводительном ДНК-синтезаторе Applied Biosystems 3900 с использованием стандартной химии фосфорамидитов (Caruthers, 1982). С нитей снимали защиту, очищали, обессоливали и сушили в вакууме на скоростном вакуумном концентраторе и хранили при -20°С. Концентрации нитей определяли с использованием коэффициентов экстинкции при 260 нм, оцененных методом NN (Cantor et al ., 1970). Чистота и точность образца были подтверждены масс-спектрометрическим анализом MALDI-TOF на Sequenom (Sequenom Inc., Сан-Диего, Калифорния). Олигонуклеотиды были сконструированы и синтезированы таким образом, что шесть из них были богаты AT (содержание GC <45%), шесть имели равные пропорции AT и GC (содержание GC 45–55%), а шесть были богаты GC (содержание GC -содержание >55%).

Эксперименты по оптическому плавлению проводили на УФ-видимом спектрофотометре Cary 400 BIO (Varian Inc., Пало-Альто, Калифорния) для определения температуры плавления этих олигонуклеотидов.Образцы регидратировали в плавящемся буфере (10 мМ фосфата натрия, pH 8,3, содержащем 20 мМ NaCl, в результате чего общее [Na + ] составило 50 мМ. Профиль поглощения в зависимости от температуры измеряли при 260 нм при скорости нагревания 1°C. Для каждого образца были получены не менее трех полных переходных кривых.Конденсация воды на внешней стороне кюветы в низкотемпературном диапазоне была предотвращена путем промывки постоянным потоком сухого газа N 2 . T m значения были рассчитывают по первым производным кривых плавления.Из 90 других олигонуклеотидов, рассмотренных для исследования, 30 были получены в работе Owczarzy et al . (1997) и 60 из отчета Owczarzy et al . (2004). В последнем случае T m для каждого олигонуклеотида определяли при различных концентрациях Na + ([Na + ]), 69 мМ, 119 мМ, 220 мМ, 621 мМ и 1020 мМ.

T м предсказания

После тщательного поиска во всемирной паутине было отобрано 25 свободно доступных калькуляторов свойств олигонуклеотидов.Предсказание T m также было выполнено с использованием модуля DNASTAR (имеется у нас) и расчетного модуля T m системы GeneAmp-PCR 9700 (Applied Biosystems, Foster City, CA). T m было предсказано для всего 108 олигонуклеотидов, которые имели длину от 17 до 30 нуклеотидов и %GC-содержание от 8 до 80.

Статистический анализ

Все олигонуклеотиды были сгруппированы в три категории: AT-богатые (GC <45%), AT≈GC (содержание GC от 45 до 55%) и GC-богатые (GC >55%).Для каждого олигонуклеотида рассчитывали разницу между экспериментально определенными T m и предсказанными T m . Оценки методом наименьших квадратов были рассчитаны для прогнозов каждой категории олигонуклеотидов каждого калькулятора. {\hbox{opt}}\right)\)

ПЦР.{+}\right]\)

и соответствующие концентрации матрицы. Применение термодинамической модели NN для прогнозирования T m полимеров хорошо зарекомендовало себя (Санта-Люсия, 1998). Параметры m и n в уравнении (1) были оптимизированы для минимизации ошибки прогнозирования с помощью пошаговых инкрементных итераций с использованием суммы квадратов. Была предпринята попытка оптимизации параметров в уравнении (2), поскольку их точность подробно обсуждалась ранее (von Ahsen et al ., 2001).

Исследования вторичной конструкции

Электрофорез 18 (9 смысловых и 9 антисмысловых, комплементарных) 5′-меченых олигонуклеотидов (20 пмоль) проводили, как описано в Yoshizawa et al. . (1997) на 20% полиакриламидном геле, содержащем 7 М мочевины в ТВЕ (рН 8,3) при 4°С. Затем это анализировали на авторадиограмме. Были проведены исследования плавления одной цепи в зависимости от концентрации, чтобы определить, являются ли наблюдаемые вторичные структуры самодимерами или шпильками. Количество вторичных структур, которые может образовать каждый олигонуклеотид, было предсказано с использованием шести различных калькуляторов.

Первичные проектные исследования

Из генома человека было выбрано девять участков (каждый по 1 т.п.н.). Из этих матриц три были AT-богаты (из генов AMPK, NKX6.1, F3), три имели равные пропорции AT и GC (из генов PKLR, NKX6.1, ISL1) и три были GC-богаты (из VEGF). , ИПФ1, ИНС). Повторный маскирующий анализ гарантировал, что эти области не содержат повторов.Праймеры были разработаны для амплификации этих областей с использованием 10 свободно доступных инструментов для разработки праймеров и модуля DNASTAR «Primer Select». Была синтезирована лучшая пара праймеров, выбранная из каждого инструмента, и была предпринята попытка оптимизации ПЦР. Первоначально праймеры были разработаны, синтезированы и оптимизированы только для одного шаблона каждой категории. После первоначального анализа были проанализированы праймеры еще для двух матриц каждого вида.

РЕЗУЛЬТАТЫ

T м предсказания

Температура плавления для всех 108 олигонуклеотидов (дополнительная таблица 1), рассмотренных для исследования, была предсказана с использованием калькуляторов свойств 25 олигонуклеотидов.Как упоминалось ранее, некоторые калькуляторы имели более одного модуля, например Basic, SA и NN. В каждом модуле используется разная методология расчета T m . Модули, в которых отсутствовали спецификации принятой методологии, были отнесены к группе «разное». Модули, рассчитывающие Basic T m , не учитывали концентрации солей и олигонуклеотидов. В модулях, рассчитывающих SA T m , значение по умолчанию [Na + ] равно 50 мМ, а для вычисления NN T m значения по умолчанию [Na + ] и [oligo ] составляют 50 мМ и 250 пМ соответственно. В модулях, имевших окно для изменения параметров, были предусмотрены значения [Na + ] и [oligo], при которых экспериментально определено T m .

На первом этапе анализа T m было предсказано для всех олигонуклеотидов с использованием всех 56 модулей (дополнительная таблица 2) с указанием применимых параметров. Для 60 олигонуклеотидов, для которых T m было определено в пяти различных [Na + ] (Owczarzy et al ., 2004), на этой фазе использовали T m , определенные только при 69 мМ. Для каждого прогноза вычислялись оценки методом наименьших квадратов и среднеквадратичные значения. Уравнения, которые вычисляют T m с использованием %G+C-содержания, плохо работают для олигонуклеотидных дуплексов; в частности, поскольку эти уравнения не учитывают бимолекулярное инициирование и влияние концентрации цепей, что приводит к высоким значениям среднеквадратичного отклонения. В результате этого анализа были отобраны 25 модулей, которые имели предсказания со значениями rmsd ≤5.GC-содержание олигонуклеотидов не влияло на точность прогнозов.

T m — это не просто свойство состава олигонуклеотида, но свойство олигонуклеотида в определенных условиях и при данной концентрации. Следовательно, на втором этапе анализа T m для 60 олигонуклеотидов при различных концентрациях [Na + ] (Owczarzy et al ., 2004) было рассчитано с использованием 17 из 25 модулей (рис.1), у которого было окно для изменения параметров. Отобранные олигонуклеотиды были сгруппированы в AT-богатые (25), AT≈GC (13) и GC-богатые (22) в соответствии с описанным критерием. Для каждого прогноза вычислялись значения наименьших квадратов и среднеквадратичных значений. Все модули типа NN принимают дублетный формат предсказания термодинамической стабильности, зависящей от последовательности ДНК, в котором они рассматривают все взаимодействия NN (H-связывание и стэкинг) в одном параметре (Owczarzy, et al. ., 1997).

Модули SA не могут работать лучше, чем модули NN.Даже в модулях NN те, которые приняли устаревшие термодинамические параметры (Breslauer et al ., 1986), дали огромное среднее отклонение в диапазоне 7°C, что хорошо согласуется с более ранними отчетами (SantaLucia и Хикс, 2004). Модуль Allawi калькулятора MELTING (Le Novere, 2001) с поправками на соль по умолчанию (Santa Lucia, 1998) (http://bioweb.pasteur.fr/seqanal/interfaces/melting.html), NN калькулятора oligo (McLab) ( http://tool.mclab.com/toolbox/oligo_calculator.jsp) и NN T m Расчет для Oligos (Biomath Calculator; Promega) (http://www.promega.com/biomath/default.htm) имел очень меньшее среднее отклонение в прогнозе T m при различном [Na + ] и GC-содержании (рис. 1). Статистический анализ (табл. 1) показывает, что разница между их средними отклонениями при разных [Na + ] не была достоверной ( P >0,05). Это подчеркивает, что эти калькуляторы работают одинаково хорошо. HYTHER (http://ozone2.chem.wayne.edu/) показал хорошие результаты на всех применимых [Na + ] выше 69 мМ, а анализатор Oligo 3.0 (IDT Biotools) — на 1020 мМ [Na + ]. Средние отклонения в прогнозах T m HYTHER и анализатора Oligo 3.0 (IDT Biotools) (http://scitools.idtdna.com/scitools/Applications/OligoAnalyzer/Default.aspx) при отдельном рассмотрении (рис. 1) кажутся меньшими при других концентрациях [Na + ], но при сравнении с другими калькуляторами (таблица 1) их предсказания значительно расходятся ( P <0.05). Однако, учитывая погрешности до 2°С в экспериментальных определениях температуры плавления, статистически значимые отклонения, наблюдаемые в предсказаниях HYTHER при низких концентрациях солей ( P = 0,022), могут быть незначительными с экспериментальной точки зрения. Калькулятор температуры плавления-консенсус (теперь он называется dnaMATE 1.0) (http://dna.bio.puc.cl/cardex/servers/dnaMATE/index.html) был недавно разработан, но, по-видимому, он работает не лучше, чем существующие. Отметим, что 50,92% олигонуклеотидов, которые мы использовали для нашего анализа, лежат в зоне 2, 25,93% в зоне 1, 23,15% в зоне 0 и ни одного в зоне 3 участков Паньковича. Вкратце, Зона 1 соответствует сходству в предсказаниях T m между Бреслауэром и др. . (1986) и Сугимото и др. . (1996 г.); Зона 2 сходства между Santalucia и др. . (1996) и Сугимото и др. . (1996 г.); Зона 3 между всеми тремя и в Зоне 0 ни один из наборов параметров NN не имел одинаковых значений T m (Panjkovich and Melo, 2005).Такое расположение олигонуклеотидов на графиках Паньковича может дать представление о наблюдаемых различиях в прогнозах.

Помимо T m свободная энергия гибридизации и доля гибридизованных олигомеров также имеют большое прогностическое значение при конструировании олиго. Из хорошо зарекомендовавших себя калькуляторов модуль Allawi для MELTING, NN of T m Расчет для Oligos (Biomath Calculator; Promega) и HYTHER позволяют прогнозировать свободную энергию. {\hbox{opt}}\)

Оптимальная температура отжига была предсказана эмпирически для набора из 41 ампликона.{+}\right]+0.41(\%\hbox{ GC })-528/n\]

(4)

Фактором, который ограничивает широкое применение этого уравнения, является смещение T m , которое было получено эмпирическим путем. Наша попытка преодолевает это ограничение и позволяет прогнозировать в зависимости от последовательности и основного состава T m наименее стабильного праймера и предсказывает T m продукта на основе термодинамики NN с учетом поправок NN для Mg 2 + и dNTP.Обоснование использования T m наименее стабильного праймера уже было объяснено (von Ahsen et al. ., 2001).

Исследования вторичной конструкции

Мы выбрали комплементарные смысловые и антисмысловые нити для наших исследований, потому что хорошо известно, что предсказанные вторичные структуры комплементарных одиночных нитей не являются зеркальными отражениями, и их свертывание не приводит к одинаковому уменьшению свободной энергии (Nielsen et al . , 1995). Для выбранных нами последовательностей большое количество вторичных структур было предсказано с помощью различных вычислителей свойств олигонуклеотидов, включая наиболее широко используемый алгоритм предсказания вторичной структуры MFOLD (Zuker, 2003) (таблица 2). Для смысловых и антисмысловых цепей предусмотрены разные предсказания. Но из рисунка 2 видно, что только олигонуклеотиды 7, 10, 11, 12 и 14 образуют вторичную структуру. Исследования одноцепочечного плавления в зависимости от концентрации установили, что эти структуры не являются результатом межмолекулярных взаимодействий.Следовательно, эти структуры считаются шпильками. Наличие незначительных вторичных структур в этих олигонуклеотидах при 4°C ставит под сомнение само существование стабильных структур при температурах, используемых во время молекулярно-биологических экспериментов, ставя под сомнение достоверность таких предсказаний. Однако все программы, кроме калькулятора свойств олигонуклеотидов, дают свободную энергию предсказанных структур. Отметим, что это может дать информацию об устойчивости предсказанных структур.

Предварительные проектные исследования

Подробная информация о характеристиках каждого рассматриваемого инструмента разработки праймера представлена ​​в виде таблицы (Таблица 3). Хотя биологи могут изменить последовательность праймера, ДНК-мишень изменить нельзя. Анализу матрицы ПЦР перед экспериментальной процедурой обычно уделяется мало внимания. Чтобы решить эту проблему, мы выбрали шаблоны AT-rich, GC-rich и AT = GC для проверки производительности различных инструментов. В начальном анализе праймеры, созданные с помощью Primer Selection, работали хорошо.Web Primer, Primer 3 и Primer Design Assistant приводили к амплификации только в шаблонах с высоким содержанием AT и GC, а шаблоны, созданные с помощью Do Primer, Exon Primer и Pride 1.2 (Haas et al. ., 1998), хорошо работали для AT-. богатые и шаблоны AT = GC. Для второй фазы анализа Do Primer и Primer Selection не были доступны в World Wide Web. Второй этап был продолжен только для оставшихся девяти инструментов. В категории Primer 3 и Web Primer с высоким содержанием AT, в праймере Exon с AT = GC и в категории Primer Design Assistant с высоким содержанием GC Primer 3 и Primer Quest показали лучшие результаты.Только одна из трех последовательностей в классе AT = GC могла быть амплифицирована с использованием праймеров, сгенерированных Primer 3. Primer 3 удобен для пользователя, так как учитывает широкий спектр параметров и дает их полное описание, но основным его недостатком является использование устаревших параметров Бреслауера (Breslauer et al ., 1986). Сложности разработки букварей для Интернета (Бинас, 2000) и детали инструментов для разработки букварей уже рассматривались ранее (Абд-Эльсалам, 2003). Подчеркнем, что не приписывается никакой причины ни неудачам одних инструментов, ни успехам других.

ОБСУЖДЕНИЕ

В этой работе мы сравнили различные калькуляторы свойств олигонуклеотидов для оценки T m олигонуклеотидов и выполнили тест точности, используя все соответствующие последовательности, для которых доступны экспериментальные данные плавления. Целью данного исследования является не дисквалификация какого-либо из существующих методов, а демонстрация того, что между ними наблюдаются существенные различия в предсказаниях коротких последовательностей ДНК при тестировании большого количества последовательностей, имеющих практическое значение. .Этот вид оценки в некоторой степени предвзят, поскольку большинство доступных экспериментальных данных относятся к очень коротким последовательностям ДНК, а также использовались для оптимизации и параметризации существующих методов, а имеющиеся в настоящее время данные также не являются репрезентативными для пространства последовательностей олигонуклеотидов. Этот анализ охватывает все известные параметры, необходимые для оценки точности прогнозов, такие как GC-содержание олигонуклеотида, концентрация соли, при которой он плавится, концентрация цепи и длина последовательности.{\hbox{opt}}\)

, объединяющий составы, разработанные несколькими группами, можно применять в разных лабораториях, просто найдя наилучшее соответствие для m и n в уравнении (1) из уже существующего набора данных ампликона. Точность этой модели зависит от точности значений, полученных для m и n . Здесь мы демонстрируем использование термодинамики NN для прогнозирования T m продукта.

Такие соображения, как предотвращение комплементарности на 3′-концах праймеров, что способствует образованию артефактов праймер-димер, и избежание стабильных самокомплементарных петель-шпилек, повышающих стабильность праймеров, необходимы для повышения специфичности олигонуклеотидов.Хотя для определенных наборов праймеров было предсказано большое количество вторичных структур, в этих случаях наблюдалась успешная амплификация и хороший выход продукта. Хотя аппроксимации на основе длины дали важные прогнозы, необходимы правила и параметры, зависящие от последовательности, для шпилек, выпуклостей, внутренних петель и многоразветвленных петель. Для дальнейшего улучшения качества этих прогнозов требуется уточнение термодинамических параметров, характеризующих различные структурные мотивы, и включение поправок на концентрации двухвалентных катионов (необходимых для ферментативной активности) (SantaLucia and Hicks, 2004). Мы подчеркиваем, что предсказание правильной вторичной структуры является не единственной целью, но также важно точное предсказание энергии, необходимой для развертывания части длинной ДНК, чтобы олигонуклеотид мог связываться (Dong et al ., 2001). и упоминание об этом в программном обеспечении было бы большим подспорьем для наивных пользователей. Когда зонд или праймер имеют некоторые вторичные структуры, возникает конкуренция между образованием вторичной структуры и связыванием с мишенью. Соответствующие склонности к образованию вторичной структуры и образованию дуплекса в конечном итоге определяют актуальность данной вторичной структуры.Для оценки исхода этого соревнования требуется предсказание свободных энергий. Таким образом, мы предостерегаем конечных пользователей от исключения хороших в других отношениях праймеров при разработке праймеров для различных приложений только на основании количества вторичных структур, предсказанных используемым ими программным обеспечением.

Хотя существует роскошь экспериментальной оптимизации различных параметров, плохие прогнозы при разработке праймеров недопустимы. Затраты и время, затрачиваемые на эксперименты, огромны, и поэтому минимизация сбоев крайне важна.Общие показатели успешности ПЦР обычно снижаются из-за различий в последовательности и длине матрицы. Кроме того, сообщалось, что региональное GC-содержание матричной ДНК является сильным предиктором успеха ПЦР (Benita et al. ., 2003). Используя три различные категории шаблонов для анализа, мы даем представление о том, какой инструмент обеспечивает лучший дизайн в зависимости от содержимого шаблона GC. Разные инструменты идут на компромисс по разным соображениям и, следовательно, имеют множество ограничений.Хотя это не исчерпывающее упражнение для определения эффективности каждого инструмента, наше исследование дает представление об этом аспекте. Мы считаем, что этот сравнительный анализ предоставит некоторые рекомендации, которым следует следовать, чтобы избежать или свести к минимуму большие и частые недостатки в разработке праймеров.

Мы с готовностью признаем, что это исследование направлено на обеспечение безопасного применения текущих методов, доступных бесплатно для всех, с учетом их ограничений и ограничений, а не на разработку новых методов или добавление еще одного программного обеспечения или сервера к существующим.Мы считаем, что наше исследование поможет увеличить успех различных практических приложений, связанных с олигонуклеотидами.

Рис. 1

Сравнение различных калькуляторов свойств олигонуклеотидов с окном для изменения концентрации соли и олигонуклеотида. Сравниваются прогнозы для пяти различных концентраций [Na + ]. Значение, указанное для каждого столбца, представляет собой среднее отклонение T m (°C) в прогнозах каждого калькулятора при указанной концентрации [Na + ].Номер, указанный в квадратных скобках, соответствует серийному номеру. модуля в дополнительной таблице 2.

Рис. 1

Сравнение различных калькуляторов свойств олигонуклеотидов с окном для изменения концентрации соли и олиго. Сравниваются прогнозы для пяти различных концентраций [Na + ]. Значение, указанное для каждого столбца, представляет собой среднее отклонение T m (°C) в прогнозах каждого калькулятора при указанной концентрации [Na + ].Номер, указанный в квадратных скобках, соответствует серийному номеру. модуля в дополнительной таблице 2.

Таблица 1

Статистический анализ средних отклонений в T m прогнозы

Модули . Тип . P -значения для среднего T m прогноз при разных [Na + ] .
. . 69 мМ . 119 мМ . 220 мМ . 621 мМ . 1020 мМ . 90 684
олиго анализатор 3. 0 (ИДТ Biotools) Н.Н. <0,0001 <0,0001 <0,0001 <0,0001 Л.Д.
Олигонуклеотидные свойства калькулятор SA <0.0001 <0,0001 <0,0001 <0,0001 <0.0001
Олигонуклеотидные свойства калькулятор NN <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
Анализатор олигонуклеотидов (RNAture) NN <0,0001 <0,0001 <0,0001 <0,0001 <0,0001 <0,00010001
олиго калькулятор (McLab) С.А. <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
олиго калькулятор (McLab) Н.Н. 0,795 0.475 0.05518 0.055 0.241 0.667
T м Расчет для олигос (Calculator Biomath; Proomega) NN 0. 073 Л.Д. Л.Д. Л.Д. 0,295
биополимер калькулятор (Schepartz лаборатории) С.А. 0,011 0,0054 0,102 <0,0001 <0,0001
Т M Calc (Roche) MISC <0.0001 <0 0,0001 <0 0,0001 <0.0001 <0 0,0001 <0.0001 allowi Nn Ld 0.472 0,0524 0,405 0,661
ПЛАВЛЕНИЕ-Сугимото 95 Н.Н. <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
ПЛАВЛЕНИЕ-Сугимото 96 NN <0.0001 <0.0001 <0.0001 <0 0,0001 <0 0,0001 <0 0,0001 <0 0,0001
Анализатор последовательности (Synthegen) Nn <0. 0001 <0,0001 <0,0001 <0,0001 0,0004
Температура плавления калькулятор С.А. <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
Калькулятор температуры плавления; Сугимото NN <0,0001 <0,0001 0,0065 <0,0001 <0.0001 
Калькулятор температуры плавления; Консенсус Н.Н. <0,0001 <0,0001 0,007 <0,0001 <0,0001
Гибридизационные термодинамика (HYTHER) NN 0,022 1,0 0,811 0,185 Вариант недоступно 
Калькулятор свойств олигонуклеотидов0001
Модули . Тип . P -значения для среднего T m прогноз при разных [Na + ] .
. . 69 мМ . 119 мМ . 220 мМ . 621 мМ . 1020 мМ .
Олигоанализатор 3.0 (IDT Biotools) NN <0.0001 <0,0001 <0,0001 <0,0001 Л.Д.
Олигонуклеотидные свойства калькулятор SA <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
калькулятор свойств олигонуклеотидов0001
Олигонуклеотид анализатор (RNAture) Н.Н. <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
олиго калькулятор (McLab) С.А. <0,0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001
Олиго калькулятор (Mclab) NN 0,795 0. 475 0,055 0,241 0,667
Т м Расчет для олиго (Biomath калькулятор; Promega) Н.Н. 0,073 Л.Д. Л.Д. Л.Д. 0,295
биополимерный калькулятор (лаборатория Schepartz) SA 0.011 0.011 0.0054 0.102 <0.0001 <0 0,0001

2

T M Calc (Roche) MISC <0.0001 <0,0001 <0,0001 <0,0001 <0,0001
ПЛАВЛЕНИЕ-Аляуй Н.Н. Л.Д. 0,472 0,0524 0,405 0,661
ПЛАВЛЕНИЕ-Сугимото 95 Nn Nn <0.0001 <0.0001 <0 0,0001 <0 0,0001 <0 0,0001
Melling-Sugimoto 96 NN <0. 0001 <0,0001 <0,0001 <0,0001 <0,0001
анализатора последовательностей (Synthegen) Н.Н. <0,0001 <0,0001 <0,0001 <0,0001 0,0004
Калькулятор температуры плавления SA SA <0 0,0001 <0 0,0001 <0 0,0001 <0 0,0001 <0 0,0001 <0 0,0001
Калькулятор температуры плавления; Сугимото NN <0.0001 <0,0001 0,0065 <0,0001 <0,0001
Калькулятор температуры плавления; Консенсус Н.Н. <0,0001 <0,0001 0,007 <0,0001 <0,0001
Гибридизационные термодинамика (HYTHER) NN 0,022 1,0 0,811 0,185 Вариант недоступно . Тип . P -значения для среднего T m прогноз при разных [Na + ] .
. . 69 мМ . 119 мМ . 220 мМ . 621 мМ . 1020 мМ .
Олигоанализатор 3.0 свойства (ИДТ Biotools) Н.Н. <0,0001 <0,0001 <0,0001 <0,0001 Л.Д.
Олигонуклеотидные калькулятор SA <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
Олигонуклеотид анализатор (RNAture) Н.Н. <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
олиго калькулятор (McLab) SA <0. 0001 <0 0,0001 <0 0,0001 <0 0,0001 <0 0.0001 <0 0,0001
Олиго калькулятор (Mclab) NN 0.795 +0,475 0,055 0,241 0,667
Т расчет м для олиго (Biomath калькулятор; Promega) Н.Н. 0,073 Л.Д. Л.Д. Л.Д. 0,295
биополимер калькулятор (Schepartz лаборатории) С.А. 0,011 0,0054 0,102 <0,0001 <0,0001
Т м известково (Roche) Разное < 0.0001 <0,0001 <0,0001 <0,0001 <0,0001
ПЛАВЛЕНИЕ-Аляуй Н.Н. Л.Д. 0,472 0,0524 0,405 0,661
ПЛАВЛЕНИЕ-Сугимото 95 Nn Nn <0. 0001 <0.0001 <0 0,0001 <0 0,0001 <0 0,0001
Melling-Sugimoto 96 NN <0.0001 <0,0001 <0,0001 <0,0001 <0,0001
анализатора последовательностей (Synthegen) Н.Н. <0,0001 <0,0001 <0,0001 <0,0001 0,0004
Калькулятор температуры плавления SA SA <0 0,0001 <0 0,0001 <0 0,0001 <0 0,0001 <0 0,0001 <0 0,0001
Калькулятор температуры плавления; Сугимото NN <0.0001 <0,0001 0,0065 <0,0001 <0,0001
Калькулятор температуры плавления; Консенсус Н.Н. <0,0001 <0,0001 0,007 <0,0001 <0,0001
Гибридизационные термодинамика (HYTHER) NN 0,022 1,0 0,811 0,185 Вариант недоступно 
Калькулятор свойств олигонуклеотидов0001
Модули . Тип . P -значения для среднего T m прогноз при разных [Na + ] .
. . 69 мМ . 119 мМ . 220 мМ . 621 мМ . 1020 мМ .
Олигоанализатор 3.0 свойства (ИДТ Biotools) Н.Н. <0,0001 <0,0001 <0,0001 <0,0001 Л.Д.
Олигонуклеотидные калькулятор SA <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
Олигонуклеотид анализатор (RNAture) Н.Н. <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
олиго калькулятор (McLab) SA <0. 0001 <0 0,0001 <0 0,0001 <0 0,0001 <0 0.0001 <0 0,0001
Олиго калькулятор (Mclab) NN 0.795 +0,475 0,055 0,241 0,667
Т расчет м для олиго (Biomath калькулятор; Promega) Н.Н. 0,073 Л.Д. Л.Д. Л.Д. 0,295
биополимер калькулятор (Schepartz лаборатории) С.А. 0,011 0,0054 0,102 <0,0001 <0,0001
Т м известково (Roche) Разное < 0.0001 <0,0001 <0,0001 <0,0001 <0,0001
ПЛАВЛЕНИЕ-Аляуй Н.Н. Л.Д. 0,472 0,0524 0,405 0,661
ПЛАВЛЕНИЕ-Сугимото 95 Nn Nn <0. 0001 <0.0001 <0 0,0001 <0 0,0001 <0 0,0001
Melling-Sugimoto 96 NN <0.0001 <0,0001 <0,0001 <0,0001 <0,0001
анализатора последовательностей (Synthegen) Н.Н. <0,0001 <0,0001 <0,0001 <0,0001 0,0004
Калькулятор температуры плавления SA SA <0 0,0001 <0 0,0001 <0 0,0001 <0 0,0001 <0 0,0001 <0 0,0001
Калькулятор температуры плавления; Сугимото NN <0.0001 <0,0001 0,0065 <0,0001 <0,0001
Калькулятор температуры плавления; Консенсус Н.Н. <0,0001 <0,0001 0,007 <0,0001 <0,0001
Гибридизационные термодинамика (HYTHER) NN 0,022 1,0 0,811 0,185 Вариант недоступен 

Рис. 2

Анализ вторичных структур олигонуклеотидов. С1: Т-21; С2: Т-24; С3: Т-18. Номера олигонуклеотидов соответствуют последовательностям в таблице 3.

Рис. 2

Анализ вторичных структур в олигонуклеотидах. С1: Т-21; С2: Т-24; С3: Т-18. Номера олигонуклеотидов соответствуют последовательностям в таблице 3.

Таблица 2

Прогнозирование вторичной структуры с помощью различных инструментов

+ + +
S.нет. . Олигонуклеотидная последовательность . MFOLD . Oligo Analyzer 3.0 (IDT Biotools) . Калькулятор свойств олигонуклеотидов . Net Primer (Премьер Биософт) . Анализатор олигонуклеотидов (RNAture) . Primer Select (DNA STAR) .
HP SD HP SD HP SD HP SD HP SD HP
1 GATTTGGCTGTGATTAGCCC 2 8 2 0 0 1 1 1 1 6 3
2 GGGCTAATCACAGCCAAATC 1 8 1 0 1 1 1 1 1 5 3
3 CTCCGGGGGCCACACTCACGC 1 8 1 0 0 2
4  9 0718 GCGTGAGTGTGGCCCCCGGAG 6 8 1 0 0 2 0 1 1 8 4
5 GGCCAAGGCTGGGGTTGAAGG 2 8 2 0 0 1 1 1 1 4 7
6 CCTTCAACCCCAGCCTTGGCC 2 8 2 0 0 4 2 1 1 7 7
7 AAAACAAAGACTTTCTTAAGAGAT 2 8 2 2 1 4 0 1 15 
ATCTCTTAAGAAAGTC TTTGTTTT 5 8 2 2 0 5 2 1 1 10 15
9 CATATGTTTCATATATTAGCTAGA 1 8 1 2 2 8 1 1 1 10 10
10 TCTAGCTAATATATGAAACATATG 1 8 1 2 0 8 2 1 1 9 10
11 AAGTGACAAGGATGGGCCTCAATC 1 8 1 0 0 3 1 1 1 10 7
12 GATTGAGGCCCATCCTTGTCACTT 9 0718 2 8 1 0 0 2 1 1 1 5 7
13 AGAGATGTAAAATTTTCATGATGTT 5 8 1 4 0 3 0 1 1 9 12
14 AACATCATGAAAATTTTACATCTCT 6 8 1 4 0 2 0 1 1 7 12
15 TTAGGTCAGTGGTCCCAAGTAG 3 8 1 0 0 0 0 1 1
16  CTACTTGGGACCACTGACCTAA  5  9 0718 8 2 0 0 0 0 1 1 5 4
17 TGAGGCAGCCCCGTTGAG 5 8 3 0 0 0 0 1 1 3 5
18 CTCAACGGGGCTGCCTCA 4 8 2 0 0 1 0
+ + +
С. нет. . Олигонуклеотидная последовательность . MFOLD . Oligo Analyzer 3.0 (IDT Biotools) . Калькулятор свойств олигонуклеотидов . Net Primer (Премьер Биософт) . Анализатор олигонуклеотидов (RNAture) . Primer Select (DNA STAR) .
HP SD HP SD HP SD HP SD HP SD HP
1 GATTTGGCTGTGATTAGCCC 2 8 2 0 0 1 1 1 1 6 3
2 GGGCTAATCACAGCCAAATC 1 8 1 0 1 1 1 1 1 5 3
3 CTCCGGGGGCCACACTCACGC 1 8 1 0 0 2
4  9 0718 GCGTGAGTGTGGCCCCCGGAG 6 8 1 0 0 2 0 1 1 8 4
5 GGCCAAGGCTGGGGTTGAAGG 2 8 2 0 0 1 1 1 1 4 7
6 CCTTCAACCCCAGCCTTGGCC 2 8 2 0 0 4 2 1 1 7 7
7 AAAACAAAGACTTTCTTAAGAGAT 2 8 2 2 1 4 0 1 15 
ATCTCTTAAGAAAGTC TTTGTTTT 5 8 2 2 0 5 2 1 1 10 15
9 CATATGTTTCATATATTAGCTAGA 1 8 1 2 2 8 1 1 1 10 10
10 TCTAGCTAATATATGAAACATATG 1 8 1 2 0 8 2 1 1 9 10
11 AAGTGACAAGGATGGGCCTCAATC 1 8 1 0 0 3 1 1 1 10 7
12 GATTGAGGCCCATCCTTGTCACTT 9 0718 2 8 1 0 0 2 1 1 1 5 7
13 AGAGATGTAAAATTTTCATGATGTT 5 8 1 4 0 3 0 1 1 9 12
14 AACATCATGAAAATTTTACATCTCT 6 8 1 4 0 2 0 1 1 7 12
15 TTAGGTCAGTGGTCCCAAGTAG 3 8 1 0 0 0 0 1 1
16  CTACTTGGGACCACTGACCTAA  5  9 0718 8 2 0 0 0 0 1 1 5 4
17 TGAGGCAGCCCCGTTGAG 5 8 3 0 0 0 0 1 1 3 5
18 CTCAACGGGGCTGCCTCA 4 8 2 0 0 1 0
нет. . Олигонуклеотидная последовательность . MFOLD . Oligo Analyzer 3.0 (IDT Biotools) . Калькулятор свойств олигонуклеотидов . Net Primer (Премьер Биософт) . Анализатор олигонуклеотидов (RNAture) . Primer Select (DNA STAR) . + HP SD HP SD HP SD HP SD HP SD HP + + 1 GATTTGGCTGTGATTAGCCC 2 8 2 0 0 1 1 1 1 6 3 2 GGGCTAATCACAGCCAAATC 1 8 1 0 1 1 1 1 1 5 3 3 CTCCGGGGGCCACACTCACGC 1 8 1 0 0 2 0  1  1  4  4  4  9 0718 GCGTGAGTGTGGCCCCCGGAG 6 8 1 0 0 2 0 1 1 8 4 5 GGCCAAGGCTGGGGTTGAAGG 2 8 2 0 0 1 1 1 1 4 7 6 CCTTCAACCCCAGCCTTGGCC 2 8 2 0 0 4 2 1 1 7 7 7 AAAACAAAGACTTTCTTAAGAGAT 2 8 2 2 1 4 0 1 1  6  15  8  ATCTCTTAAGAAAGTC TTTGTTTT 5 8 2 2 0 5 2 1 1 10 15 9 CATATGTTTCATATATTAGCTAGA 1 8 1 2 2 8 1 1 1 10 10 10 TCTAGCTAATATATGAAACATATG 1 8 1 2 0 8 2 1 1 9 10 11 AAGTGACAAGGATGGGCCTCAATC 1 8 1 0 0 3 1 1 1 10 7 12 GATTGAGGCCCATCCTTGTCACTT 9 0718 2 8 1 0 0 2 1 1 1 5 7 13 AGAGATGTAAAATTTTCATGATGTT 5 8 1 4 0 3 0 1 1 9 12 14 AACATCATGAAAATTTTACATCTCT 6 8 1 4 0 2 0 1 1 7 12 15 TTAGGTCAGTGGTCCCAAGTAG 3 8 1 0 0 0 0 1 1 5  4  16  CTACTTGGGACCACTGACCTAA  5  9 0718 8 2 0 0 0 0 1 1 5 4 17 TGAGGCAGCCCCGTTGAG 5 8 3 0 0 0 0 1 1 3 5 18 CTCAACGGGGCTGCCTCA 4 8 2 0 0 1 0 1  1  7  5  + + +
С. нет. . Олигонуклеотидная последовательность . MFOLD . Oligo Analyzer 3.0 (IDT Biotools) . Калькулятор свойств олигонуклеотидов . Net Primer (Премьер Биософт) . Анализатор олигонуклеотидов (RNAture) . Primer Select (DNA STAR) .
HP SD HP SD HP SD HP SD HP SD HP
1 GATTTGGCTGTGATTAGCCC 2 8 2 0 0 1 1 1 1 6 3
2 GGGCTAATCACAGCCAAATC 1 8 1 0 1 1 1 1 1 5 3
3 CTCCGGGGGCCACACTCACGC 1 8 1 0 0 2
4  9 0718 GCGTGAGTGTGGCCCCCGGAG 6 8 1 0 0 2 0 1 1 8 4
5 GGCCAAGGCTGGGGTTGAAGG 2 8 2 0 0 1 1 1 1 4 7
6 CCTTCAACCCCAGCCTTGGCC 2 8 2 0 0 4 2 1 1 7 7
7 AAAACAAAGACTTTCTTAAGAGAT 2 8 2 2 1 4 0 1 15 
ATCTCTTAAGAAAGTC TTTGTTTT 5 8 2 2 0 5 2 1 1 10 15
9 CATATGTTTCATATATTAGCTAGA 1 8 1 2 2 8 1 1 1 10 10
10 TCTAGCTAATATATGAAACATATG 1 8 1 2 0 8 2 1 1 9 10
11 AAGTGACAAGGATGGGCCTCAATC 1 8 1 0 0 3 1 1 1 10 7
12 GATTGAGGCCCATCCTTGTCACTT 9 0718 2 8 1 0 0 2 1 1 1 5 7
13 AGAGATGTAAAATTTTCATGATGTT 5 8 1 4 0 3 0 1 1 9 12
14 AACATCATGAAAATTTTACATCTCT 6 8 1 4 0 2 0 1 1 7 12
15 TTAGGTCAGTGGTCCCAAGTAG 3 8 1 0 0 0 0 1 1
16  CTACTTGGGACCACTGACCTAA  5  9 0718 8 2 0 0 0 0 1 1 5 4
17 TGAGGCAGCCCCGTTGAG 5 8 3 0 0 0 0 1 1 3 5
18 CTCAACGGGGCTGCCTCA 4 8 2 0 0 1 0
Таблица 3

Подробная информация об инструментах для проектирования букварей и их характеристики

Таблица 3

Подробная информация об инструментах для проектирования букварей и их характеристики

Авторы благодарят проф. С.К. Брахмачари, директору IGIB, за его поддержку. Авторы благодарят г-жу Виджая Банерджи и г-на Амитабха Шарму (Институт геномики и интегративной биологии) за их критический вклад. Авторы благодарят доктора К. Нараянасами и мистера Мохда Надима Хана (Центр геномных приложений) за их помощь в синтезе олигонуклеотидов. SC, AM и RT выражают признательность CSIR, правительству Индии, за предоставление стипендий для докторантов. Это исследование было поддержано проектом целевой группы CSIR «Прогностическая медицина с использованием полиморфизмов повторов и одиночных нуклеотидов» (CMM0016) и проектом «Генетические и протеомные исследования сахарного диабета» (OLP 0030), финансируемыми CSIR.Авторы также благодарят доктора Алекса Бейтмана, исполнительного редактора Bioinformatics, за предоставленную им возможность опубликовать свою работу.

Конфликт интересов : не объявлено.

ССЫЛКИ

Абд-Эльсалам, К.А.

2003

Биоинформационные инструменты и руководство по разработке праймеров для ПЦР.

фр. Дж. Биотехнология.

2

91

–95

Allawi, H.T. и Santa Lucia, J., Jr.

1997

Термодинамика и ЯМР внутренних несоответствий G-T в ДНК.

Биохимия

36

10581

–10594

Benita, Y., et al.

2003

Регионализованное содержание GC матричной ДНК как предиктор успеха ПЦР.

Рез. нуклеиновых кислот.

31

e99

Бинас, М.

2000

Разработка праймеров для ПЦР в Интернете.

Biotechniques

29

988

–990

Breslauer, K.J., et al.

1986

Прогнозирование стабильности ДНК-дуплекса по последовательности оснований.

Проц. Натл акад. науч. США

83

3746

–3750

Cantor, R.C., et al.

1970

Взаимодействия олигонуклеотидов. III. Исследования кругового дихроизма конформации дезоксиолигонуклеотидов и аналогов дезоксиолигонуклеотидов.

Биополимеры

9

1059

–1077

Caruthers, M.H. В Гассен, Х. Г. и Ланг, А. (ред.).

Химический и ферментативный синтез фрагментов генов. Лабораторное руководство

1982

, Вайнхайм, Германия Verag-Chemie, стр.

71

–79

Донг Ф. и др.

2001

Предсказание вторичной структуры и структурно-специфический анализ последовательности одноцепочечной ДНК.

Рез. нуклеиновых кислот.

29

3248

–3257

Федорова О.С. и др.

1992

Влияние структуры мишени на эффективность алкилирования одноцепочечной ДНК реактивными производными антисмысловых олигонуклеотидов.

ФЭБС Письмо.

302

47

–50

Фрейер, С.М. и др.

1986

Улучшенные параметры свободной энергии для предсказания стабильности дуплекса РНК.

Проц. Натл акад. науч. США

83

9373

–9377

Gamper, H.B., et al.

1987

Гибридизация в растворе сшиваемых олигонуклеотидов ДНК с ДНК бактериофага М13. Влияние вторичной структуры на кинетику и равновесие гибридизации.

Дж. Мол. биол.

197

349

–362

Haas, S., et al.

1998

Дизайн праймера для крупномасштабного секвенирования.

Рез. нуклеиновых кислот.

26

3006

–3012

Howley, P.M., et al.

1979

Быстрый метод обнаружения и картирования гомологии между гетерологичными ДНК. Оценка геномов полиомавирусов.

Дж. Биол. хим.

254

4876

–4883

Le Novere, N.

2001

ПЛАВЛЕНИЕ, расчет температуры плавления дуплекса нуклеиновой кислоты.

Биоинформатика

17

1226

–1227

Мармур, Дж.and Dotty, P.

1962

Определение основного состава дезоксирибонуклеиновой кислоты по температуре ее термической денатурации.

Дж. Мол. биол.

5

109

–118

Nakano, S., et al.

1999

Стабильность дуплекса нуклеиновой кислоты: влияние основного состава на действие катионов.

Рез. нуклеиновых кислот.

27

2957

–2965

Nielsen, D.A., et al.

1995

Дизайн праймера SSCP основан на структуре одноцепочечной ДНК, предсказанной программой сворачивания ДНК.

Рез. нуклеиновых кислот.

23

2287

–2291

Owczarzy, R., et al.

1997

Прогнозирование зависящей от последовательности стабильности плавления коротких дуплексных олигомеров ДНК.

Биополимеры

44

217

–239

Owczarzy, R., et al.

2004

Влияние ионов натрия на дуплексные олигомеры ДНК: улучшенные прогнозы температуры плавления.

Биохимия

43

3537

–3554

Панькович А. и Мело Ф.

2005

Сравнение различных методов расчета температуры плавления коротких последовательностей ДНК.

Биоинформатика

21

711

–722

Робертсон Дж. М. и Уолш-Веллер Дж.

1998

Введение в разработку праймеров для ПЦР и оптимизацию реакций амплификации.

Методы Мол. биол.

98

121

–154

Рычлик В. и др.

1990

Оптимизация температуры отжига для амплификации ДНК in vitro .

Рез. нуклеиновых кислот.

18

6409

–6412

SantaLucia, J. , Jr.

1998

Единый взгляд на термодинамику ближайших соседей ДНК полимеров, гантелей и олигонуклеотидов.

Проц. Натл акад. науч. США

95

1460

–1465

Санта-Люсия, Дж., младший и Хикс, Д.

2004

Термодинамика структурных мотивов ДНК.

год. Преподобный Биофиз. биомол. Структура

33

415

–440

Санта-Люсия, Дж., младший и др.

1996

Улучшены параметры ближайшего соседа для прогнозирования стабильности дуплекса ДНК.

Биохимия

35

3555

–3562

Sugimoto, N., et al.

1995

Термодинамические параметры для прогнозирования стабильности гибридных дуплексов РНК/ДНК.

Биохимия

34

11211

–11216

Sugimoto, N., et al.

1996

Улучшенные термодинамические параметры и фактор инициации спирали для прогнозирования стабильности дуплексов ДНК.

Рез. нуклеиновых кислот.

24

4501

–4505

von Ahsen, N., et al.

2001

Температуры плавления олигонуклеотидов в условиях ПЦР: поправки на ближайшие соседи для концентраций Mg 2+ , дезоксинуклеотидтрифосфата и диметилсульфоксида по сравнению с альтернативными эмпирическими формулами.

клин. хим.

47

1956

–1961

Wallace, R.B., et al.

1979

Гибридизация синтетических олигодезоксирибонуклеотидов с ДНК phi chi 174: эффект несоответствия одной пары оснований.

Рез. нуклеиновых кислот.

6

3543

–3557

Xia, T., et al.

1998

Термодинамические параметры для расширенной модели ближайшего соседа для образования дуплексов РНК с парами оснований Уотсона-Крика.

Биохимия

37

14719

–14735

Yoshizawa, S., et al.

1997

Последовательности тринуклеотидной петли GNA, производящие необычайно стабильные мини-шпильки ДНК.

Биохимия

36

4761

–4767

Цукер, М.

2003

Веб-сервер Mfold для прогнозирования укладки нуклеиновых кислот и гибридизации.

Рез. нуклеиновых кислот.

31

3406

–3415

Характеристики хорошей пары праймеров для QPCR

В этом руководстве я выскажу некоторые свои мысли об особенностях хорошей пары праймеров для количественной ПЦР. Я объясню, на что обратить внимание при разработке праймеров для количественной ПЦР.

Дополнительную информацию о дизайне праймера для количественной ПЦР можно найти в нашем курсе Mastering qPCR.Используйте код 20QPCR, чтобы получить скидку 20%!

Эти функции в основном применимы к праймерам для количественной ПЦР с использованием методов интеркалирования красителей (например, SYBR Green) для анализа экспрессии генов, однако некоторые из них могут быть переведены на другие типы количественной ПЦР.

Размер продукта ПЦР: 70–200 пар оснований

Одной из основных характеристик пары праймеров для количественной ПЦР, на которую следует обратить внимание, является размер продукта, который будет создан. Рекомендуется разработать праймеры, которые будут производить продукт размером 70–200 п.н.

Слишком большой размер продукта (>200 п.н.) может снизить эффективность праймеров КПЦР, в то время как слишком маленький размер продукта (70 п.н.) может затруднить их дифференциацию от загрязняющего образования праймер-димер.

Я рекомендую стремиться к размеру продукта около 150 б.п.

Длина праймера: 18–22 п.н.


Другой важной характеристикой пары праймеров для количественной ПЦР является длина праймеров. В идеале каждый праймер должен иметь длину 18–22 п.н.; обычно 20bp является распространенным выбором.

Слишком маленький праймер для кПЦР (<18 п.н.) может увеличить вероятность того, что он свяжется с каким-либо другим участком генома, т. е. он недостаточно специфичен в отношении интересующей мишени. В противном случае слишком большой праймер для количественной ПЦР (>22 п.н.) может повысить температуру плавления праймера (Tm), что повлияет на температуру отжига и свойства связывания праймера в реакции.

Тм: 59–65

или С

Tm — еще одна важная характеристика хорошей пары праймеров для количественной ПЦР. В этом отношении Tm представляет собой температуру, при которой 50% праймера диссоциирует и становится одноцепочечным. Оба праймера для qPCR должны иметь Tm в пределах 59–65 o C и находиться в пределах 1 o C друг от друга (разница не более >3 o C).

Tm также относится к температуре отжига в реакции. Грубо говоря, температура отжига примерно на 5 o °С ниже, чем Tm праймеров.Однако это только оценка, поскольку есть и другие параметры, которые необходимо учитывать, чтобы точно определить температуру отжига.

Праймеры содержат зажим GC

Еще одна функция, которую мне нравится включать в оба моих праймера, — это зажим для GC. Проще говоря, зажим GC — это наличие либо гуанина (G), либо цитозина (C) в последних 5 основаниях праймера.

Причина использования зажима GC в праймерах заключается в том, что основания G и C содержат более сильные водородные связи по сравнению с основаниями аденина (A) и тимина (T).Следовательно, включение по крайней мере одного основания G или C ближе к концу праймера обеспечит его полное связывание с матричной последовательностью.

Однако будьте осторожны, чтобы не включить в клэмп слишком много оснований G или C, так как это может привести к снижению специфичности.

Содержание GC: 50–60%

Содержание GC — это просто количество оснований G и C, присутствующих в последовательности праймера. Рекомендуется поддерживать его на уровне 50–60%; оба праймера должны иметь одинаковые значения.

Слишком высокое содержание GC может привести к ошибочному запуску, поскольку связи GC имеют более высокое сродство к матрице по сравнению с основаниями AT, они сильнее притягиваются друг к другу.

Избегать нуклеотидных повторов

При анализе потенциальных праймеров-кандидатов для КПЦР обратите особое внимание на любые нуклеотидные повторы в последовательности. Ищите участки из> 3 одинаковых нуклеотидов подряд. Эти повторы могут снизить специфичность праймера и привести к неправильному запуску.

Праймеры, разделенные интроном

Я считаю, что одной из наиболее важных особенностей хорошей пары праймеров для количественной ПЦР является разработка прямого и обратного праймеров для связывания с отдельными экзонами гена. Таким образом, это ограничит вероятность амплификации геномной ДНК во время реакции.

ДНК

содержит интроны, которых больше нет в транскриптах мРНК. Таким образом, разделение праймеров интроном может снизить вероятность амплификации геномной ДНК, особенно если интрон очень большой.

Сосредоточьтесь на расположении праймеров для количественной ПЦР

Другим аспектом, который следует учитывать при разработке праймеров для количественной ПЦР, является расположение праймера, связывающегося с интересующим геном, особенно при нацеливании на транскрипты кДНК.

Для кДНК, которая была создана с использованием случайных гексамеров, целесообразно ли разработать пары праймеров для связывания вблизи начала гена (5′-конец).

С другой стороны, для кДНК, которая была создана с использованием олиго(dT) праймеров, спроектируйте праймеры для связывания на 3′-конце гена. Поскольку олиго(dT) праймеры нацелены на полиА-хвост транскриптов мРНК, большая часть матрицы кДНК будет основана на этом конце. Более длинные последовательности генов могут не полностью амплифицироваться в процессе обратной транскрипции.

Пара праймеров специфична для интересующей мишени

Это может показаться очевидной функцией, но она является одной из самых важных. Программное обеспечение для разработки праймеров, такое как Primer-BLAST от NCBI, может выявить любое потенциальное неправильное праймирование других частей генома. Вот почему Primer-BLAST — мой любимый инструмент для разработки грунтовок.

При запуске Primer-BLAST обратите особое внимание на любые продукты на потенциально непреднамеренных шаблонах и их длину продукта под каждой парой праймеров-кандидатов.Если длина продукта такая же, как у интересующего вас продукта, измените дизайн грунтовки

.

Также обязательно ознакомьтесь с нашим руководством по разработке праймеров для количественной ПЦР с помощью Primer-BLAST.

Заключение

В этом руководстве я обсудил некоторые полезные свойства пары праймеров для количественной ПЦР. Добавляя эти функции в свои праймеры во время разработки праймеров, вы сможете повысить эффективность своей реакции.

Определение свойств олигонуклеотидов и разработка праймеров: критический анализ предсказаний

Мотивация: Точное предсказание температуры плавления (T(m)), вторичной структуры и дизайна олигонуклеотидов определяет эффективность и успех экспериментов в молекулярной биологии.Наличие большого количества программного обеспечения и неосведомленность пользователей об их ограничениях ставит под угрозу точность и надежность прогнозов.

Результаты: Сравнительный анализ 56 модулей был проведен для предсказания T(m) с использованием большого набора олигонуклеотидных последовательностей, охватывающих весь диапазон GC-содержания и длины. Модуль Allawi калькулятора ‘MELTING’, ближайший сосед (NN) калькулятора oligo (McLab), NN расчета T(m) для Oligos (Biomath Calculator, Promega) и HYTHER обеспечили наиболее точные предсказания T(m).Также была предложена модель для расчета оптимальной температуры отжига с учетом уже опубликованных составов. Прогнозы вторичной структуры олигонуклеотидов показывают большое количество структур, в отличие от экспериментальных наблюдений. Из 11 оцениваемых инструментов разработки праймеров Primer 3 и WebPrimer показали лучшие результаты для шаблонов с высоким содержанием AT, Exon Primer для шаблонов с AT = GC и Primer Design Assistant, Primer3 и Primer Quest для шаблонов с высоким содержанием GC. Это исследование предоставляет пользователю оптимальный выбор для применения, увеличивая успех различных экспериментов, особенно тех, которые имеют высокую пропускную способность и сложные схемы анализа.

Контакт: [email protected]

Добавить комментарий

Ваш адрес email не будет опубликован.